ID: 1180947589

View in Genome Browser
Species Human (GRCh38)
Location 22:19705223-19705245
Sequence GACACTCACCTGTCCACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180947589_1180947595 10 Left 1180947589 22:19705223-19705245 CCCGCCGTGGACAGGTGAGTGTC No data
Right 1180947595 22:19705256-19705278 TAGGGGCAGAGACTCAGCCCAGG No data
1180947589_1180947592 -9 Left 1180947589 22:19705223-19705245 CCCGCCGTGGACAGGTGAGTGTC No data
Right 1180947592 22:19705237-19705259 GTGAGTGTCTACTGTTTTGTAGG No data
1180947589_1180947594 -7 Left 1180947589 22:19705223-19705245 CCCGCCGTGGACAGGTGAGTGTC No data
Right 1180947594 22:19705239-19705261 GAGTGTCTACTGTTTTGTAGGGG No data
1180947589_1180947596 11 Left 1180947589 22:19705223-19705245 CCCGCCGTGGACAGGTGAGTGTC No data
Right 1180947596 22:19705257-19705279 AGGGGCAGAGACTCAGCCCAGGG No data
1180947589_1180947597 19 Left 1180947589 22:19705223-19705245 CCCGCCGTGGACAGGTGAGTGTC No data
Right 1180947597 22:19705265-19705287 AGACTCAGCCCAGGGTCCCACGG No data
1180947589_1180947593 -8 Left 1180947589 22:19705223-19705245 CCCGCCGTGGACAGGTGAGTGTC No data
Right 1180947593 22:19705238-19705260 TGAGTGTCTACTGTTTTGTAGGG No data
1180947589_1180947598 20 Left 1180947589 22:19705223-19705245 CCCGCCGTGGACAGGTGAGTGTC No data
Right 1180947598 22:19705266-19705288 GACTCAGCCCAGGGTCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180947589 Original CRISPR GACACTCACCTGTCCACGGC GGG (reversed) Intergenic
No off target data available for this crispr