ID: 1180950538

View in Genome Browser
Species Human (GRCh38)
Location 22:19718703-19718725
Sequence CCGAGCGTGCCCCCGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180950523_1180950538 20 Left 1180950523 22:19718660-19718682 CCTCGCTGTCGCCGGGCTCTGGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 140
1180950521_1180950538 21 Left 1180950521 22:19718659-19718681 CCCTCGCTGTCGCCGGGCTCTGG 0: 1
1: 0
2: 3
3: 26
4: 179
Right 1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 140
1180950518_1180950538 28 Left 1180950518 22:19718652-19718674 CCAAGGTCCCTCGCTGTCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 140
1180950531_1180950538 -5 Left 1180950531 22:19718685-19718707 CCTGACCGGGCCTGGGGTCCGAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 140
1180950525_1180950538 9 Left 1180950525 22:19718671-19718693 CCGGGCTCTGGCGGCCTGACCGG 0: 1
1: 0
2: 1
3: 11
4: 169
Right 1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 140
1180950532_1180950538 -10 Left 1180950532 22:19718690-19718712 CCGGGCCTGGGGTCCGAGCGTGC 0: 1
1: 0
2: 0
3: 19
4: 166
Right 1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180950538 Original CRISPR CCGAGCGTGCCCCCGGGCCT GGG Intronic
900053032 1:609620-609642 CCGCGTGTGCCGCCAGGCCTGGG - Intergenic
900053142 1:610092-610114 CCGCGTGTGCCGCCAGGCCTGGG - Intergenic
900593634 1:3470750-3470772 CCGAGCCACCCTCCGGGCCTTGG - Intronic
903614785 1:24643653-24643675 CCGTGCGTGCCGCCGGGTCCTGG + Intronic
905217012 1:36415950-36415972 CTGAGTGTGTCCCAGGGCCTTGG - Intronic
908272887 1:62437431-62437453 CCGAACTTGCCCCCGCGCCCGGG - Intronic
910251177 1:85200855-85200877 CCGAGCCTGCCCCCGGGACGGGG - Exonic
911191646 1:94954716-94954738 CTAAGCATTCCCCCGGGCCTTGG + Intergenic
912486720 1:110034870-110034892 CCTAGAGTGGCCCCGGGCCCGGG - Intronic
918046032 1:180941503-180941525 CCTAGAGTGACCCCAGGCCTGGG - Intronic
921312814 1:213861392-213861414 CAGAGCCTGGCCCTGGGCCTGGG - Intergenic
922753423 1:228081733-228081755 CAGGCCCTGCCCCCGGGCCTCGG + Intergenic
923810487 1:237309716-237309738 CCGAGCCTCCCCCCGGCCATGGG - Intronic
924383429 1:243483232-243483254 CGGAGCGCGCCCCCTGGGCTGGG + Intronic
1065092971 10:22252903-22252925 CCAAGCGGGTCCCCTGGCCTCGG + Intergenic
1067346843 10:45443621-45443643 CCCAGGGTGCCCTCCGGCCTTGG + Intronic
1069599037 10:69691515-69691537 CCAAGGGTGCCTCTGGGCCTGGG + Intronic
1071490848 10:86135414-86135436 CCCATGGTGCCCCCAGGCCTGGG + Intronic
1072898508 10:99387732-99387754 GCGAGGCTGCCCCCGAGCCTGGG + Intronic
1073208572 10:101781232-101781254 CCCAGCGTGGCCCTGGGCCTGGG - Intergenic
1073503885 10:103967214-103967236 CCGCGCGTCCCCTCGGGTCTGGG - Exonic
1075106247 10:119542135-119542157 CCGACTGGGCCCCTGGGCCTGGG - Intronic
1076306281 10:129467470-129467492 CCCAGCCTTTCCCCGGGCCTGGG + Intronic
1076317463 10:129552377-129552399 ACCTGTGTGCCCCCGGGCCTGGG + Intronic
1076776321 10:132699963-132699985 CTGAGTGTGGCCCCTGGCCTTGG + Intronic
1077390443 11:2298559-2298581 CAGAGTGACCCCCCGGGCCTGGG - Intronic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081812815 11:45922891-45922913 CCGAGGGCGCCCCCGGGCGCTGG + Exonic
1082023278 11:47552755-47552777 CAGCGCGTGCCCCCGCGCCCAGG - Intronic
1083264944 11:61542333-61542355 CCGAGCCTGGCCCCGGCCATAGG + Intronic
1083679564 11:64344895-64344917 CCGGGCTTGCTCCCAGGCCTGGG - Exonic
1083710657 11:64546372-64546394 TCCAGCCTGCCCCTGGGCCTGGG - Intergenic
1084313664 11:68331430-68331452 CCCCGCCTGCCCCAGGGCCTTGG + Intronic
1084412600 11:69013181-69013203 CCGAGCGCGGCCCGGAGCCTTGG + Exonic
1085024359 11:73228028-73228050 CTGGGCGTGGCCCCAGGCCTGGG + Exonic
1089274912 11:117328171-117328193 CTGAGCGGGCCACCGGGCCCGGG + Intronic
1092253418 12:6914091-6914113 CCGAGGGCGGCCCCCGGCCTAGG - Exonic
1094526839 12:31236871-31236893 CAGAGCGTGCCCTCAGCCCTGGG + Intergenic
1094536206 12:31324617-31324639 CCGTGCGGGCCCCCGGCGCTCGG - Intronic
1104910911 12:132240566-132240588 CCGTGCGTGGCCCCGGGGCTCGG + Intronic
1104910922 12:132240598-132240620 CCGTGCGTGGCCCCGGGGCTCGG + Intronic
1106157292 13:27171175-27171197 CAGAGCGCGGCCCCGGGCCGGGG - Intronic
1111657876 13:91175246-91175268 CCCAGCGTCCCCTCGGGGCTGGG - Intergenic
1113484171 13:110642402-110642424 CCGGGCGTCCCCCGTGGCCTCGG + Exonic
1113942027 13:114023340-114023362 CCTAGGATGCCCCCGAGCCTGGG - Intronic
1114989056 14:28264440-28264462 CCGGGAGCGCCCCCGGGCCGCGG + Intergenic
1117392105 14:55271759-55271781 CTGAGCGTCCCCGCGGGCCACGG + Intronic
1119338127 14:73851858-73851880 CCCAGCTCGCCCCCAGGCCTCGG - Exonic
1121103446 14:91265041-91265063 ACGGGCTTGCCCCCGGGCCTGGG + Intergenic
1121832395 14:97063509-97063531 CCCAGCCTGGCCCTGGGCCTGGG + Intergenic
1122066175 14:99175682-99175704 CCGCCCGTGTCCCCGGGCCGCGG - Exonic
1122815052 14:104308074-104308096 CCGAGCTCTCCCCCGGGGCTCGG + Intergenic
1124469347 15:29969035-29969057 CGGAGCGCGCCGCCGGGCCACGG - Intergenic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1131179188 15:90228583-90228605 CCCAGTGTGCCCCCGGCCCCGGG + Exonic
1132901246 16:2255671-2255693 CCGTGCTGGCCCCCTGGCCTAGG - Exonic
1133029733 16:3004659-3004681 ACGAGCGCGCCCACGGGCCCAGG - Intergenic
1134137708 16:11690296-11690318 CAGAGCTTGCCCCTGGGACTTGG - Intronic
1135541764 16:23335496-23335518 CCAAGCCTGCCCTCCGGCCTGGG - Intronic
1136086791 16:27890953-27890975 CCCAGCCTGCCCACGGCCCTTGG + Intronic
1136498746 16:30659354-30659376 CCGAGCTTGCCCCAAGGCCACGG - Exonic
1137475979 16:48810729-48810751 CGCCTCGTGCCCCCGGGCCTGGG - Intergenic
1137988354 16:53129898-53129920 CCTAGCGTGTCCTAGGGCCTTGG - Intronic
1139365042 16:66427686-66427708 CTGATCGCGCCCTCGGGCCTCGG + Intronic
1139482250 16:67236965-67236987 CCGCGCGTGCCCCGGAACCTGGG - Exonic
1141161020 16:81629278-81629300 CTGAGTGTGACACCGGGCCTGGG - Intronic
1141663563 16:85454278-85454300 CCGAGGCTGCCCCAGGCCCTTGG + Intergenic
1141669615 16:85485000-85485022 CAGGGCCTGGCCCCGGGCCTAGG - Intergenic
1142130252 16:88428900-88428922 CCCAGAGTGCCCCCCTGCCTTGG + Exonic
1142176902 16:88649665-88649687 CTGAGCGTGCCCCAGGGCCTCGG - Intronic
1142259047 16:89033863-89033885 CCCTGGGTGCCCTCGGGCCTTGG - Intergenic
1143166366 17:4899162-4899184 CCGCGCGGCCCCCCGGGCCAGGG + Intronic
1145049509 17:19648584-19648606 CCGAGCGCGGCCACGGGCCAGGG - Intronic
1146270455 17:31481927-31481949 ACCAGCCTGCCCCCGGGGCTGGG - Intronic
1149990509 17:61380661-61380683 CCTAGAGTGCTCCTGGGCCTGGG - Intronic
1154501079 18:14998342-14998364 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
1160015048 18:75133927-75133949 CCCAGCGTGCCCCTGACCCTGGG - Intergenic
1160499271 18:79394357-79394379 CCGCGAGTGTCCCCAGGCCTGGG - Intergenic
1160747979 19:720477-720499 GCGAGGGGGCGCCCGGGCCTGGG + Intronic
1160771735 19:835144-835166 CCGAACGTGGCCCCGAGCCGGGG - Intergenic
1160804102 19:984226-984248 CCGCGCATGCGCCCGTGCCTCGG - Intergenic
1161487544 19:4543970-4543992 CCGAGCAGCCCCCCGCGCCTGGG - Exonic
1162744123 19:12789695-12789717 CCCCGCCTGCCCGCGGGCCTGGG - Intronic
1165068185 19:33241024-33241046 CCACGTGTGCCCCCGTGCCTTGG + Intergenic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165349732 19:35269178-35269200 CCGGCCGTGCCCCCGCGCCCCGG + Intronic
1165767344 19:38359668-38359690 CCGAGGGTGCCCCCTTCCCTTGG - Intronic
1165838587 19:38773618-38773640 CCGGGCTTGCCCCAGGGCCAGGG - Intergenic
1167391317 19:49196873-49196895 CGGTGAGTGCCCCGGGGCCTTGG + Exonic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
927958552 2:27225089-27225111 CCGAGCCAGCACCCCGGCCTTGG - Exonic
927980120 2:27369876-27369898 CGGAGCTTCCCCCTGGGCCTGGG - Exonic
928085735 2:28345216-28345238 CTGAGGGGGCCCCTGGGCCTGGG - Intergenic
936585674 2:113756154-113756176 CCGTGCGTGCGCCCTCGCCTCGG - Intronic
938500247 2:131828531-131828553 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
944495862 2:200306861-200306883 GCGACCGCGCCCCCGGGCCCCGG + Intronic
946186023 2:217980805-217980827 CCCAGAGTGCCTCAGGGCCTTGG + Intronic
948631794 2:239307203-239307225 CGGAGCCTGCCCCAGGCCCTGGG - Intronic
949032511 2:241803766-241803788 CCGCGCGCGCTCCCGGGTCTCGG - Exonic
1171771795 20:29327569-29327591 CCGAGCGTGTCCACGGGGCCAGG + Intergenic
1171896386 20:30813782-30813804 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1171968820 20:31550387-31550409 CTGCGCGTGCCCCCCGGGCTGGG - Intronic
1172421979 20:34825522-34825544 CCGTGCGTGCCCGCCGCCCTCGG + Intronic
1174113868 20:48213992-48214014 CCGAGGGTGGCCCCGCGCCAGGG - Intergenic
1174475802 20:50795018-50795040 CCGTGGTTGCGCCCGGGCCTCGG - Exonic
1176024536 20:62978928-62978950 CCGAGGGTCCCCCCGTCCCTGGG - Intergenic
1176031493 20:63015174-63015196 CCGGGTGTGTCCCCGGGCCCAGG - Intergenic
1176118035 20:63441692-63441714 CTGAGCGTGCCCCGGGGCCCAGG - Intronic
1177753410 21:25315247-25315269 CAGAGTGTGCCCCCTGGTCTGGG + Intergenic
1179496956 21:41778191-41778213 CCGGGCGTGCCCCCCGGCGGGGG - Intergenic
1179646133 21:42777417-42777439 CTGGGCATGCCCCCAGGCCTGGG - Intergenic
1179791235 21:43757137-43757159 CCCAGCCTGCCCAAGGGCCTGGG - Exonic
1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG + Intronic
1181807914 22:25386155-25386177 CCCCGCCTGCCCCAGGGCCTTGG - Intronic
1185324276 22:50218006-50218028 CCCAGGGGGCCCCCAGGCCTGGG + Exonic
951543635 3:23806121-23806143 CCGGCCGCGCCGCCGGGCCTCGG + Intronic
954205665 3:49057231-49057253 CTGAGGGTCCCCCCGGGGCTGGG + Exonic
958026659 3:88058435-88058457 CCGCCCGAACCCCCGGGCCTGGG - Intronic
960602156 3:119469124-119469146 CCGAGCCTGCCCCTTGGGCTCGG + Intronic
963798868 3:149657815-149657837 CCGAACTTGCCGTCGGGCCTGGG + Intronic
965092277 3:164179519-164179541 CCGAGCCTGCCCCCCGCCGTGGG + Intergenic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
970407666 4:15778842-15778864 CCGAGCGTGCCCGCGGGAGGCGG + Intronic
978770335 4:112449911-112449933 ACGAGCGTGCCCCAGAGGCTGGG - Intergenic
982245348 4:153344957-153344979 CCGCGGATGCCCCCGCGCCTCGG - Intronic
984667840 4:182448263-182448285 CCGCGCTCGCCCCTGGGCCTCGG - Intronic
985445547 4:190019379-190019401 CCGAGCGTGCCCACGGGCCCCGG - Intergenic
992772127 5:80058871-80058893 CAGAGGCTGCCCCCGTGCCTGGG - Intronic
994175176 5:96702948-96702970 CCGCGCGTGCTCCCGGGTCTAGG + Intronic
999258044 5:150220703-150220725 AAGAGCCTGCCCCTGGGCCTGGG + Intronic
1001563820 5:172686926-172686948 CCTAGCCTGCCCACGGGCCTTGG + Exonic
1001907735 5:175487064-175487086 CTGTGCCTGCCCTCGGGCCTAGG - Intronic
1002059871 5:176620001-176620023 GGGAGGGTGCCCCCGGGGCTGGG - Intergenic
1004217060 6:13712217-13712239 CCTAGAGCGCCCCGGGGCCTGGG - Intergenic
1006460504 6:34155035-34155057 CCGGGCGTGTCCCCGGGCGTGGG - Intronic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1019166857 6:170102941-170102963 CCGCGGCTGCCCCCGGGGCTGGG - Intergenic
1019271228 7:150194-150216 CCGAGTGTGCACGTGGGCCTCGG - Intergenic
1019342939 7:517080-517102 CCGCGCCTGCCCTCGGGCCGGGG - Intronic
1019624635 7:2009727-2009749 CAGAGCATCCCCCAGGGCCTGGG - Intronic
1029574902 7:101396945-101396967 CCCAGCGTCACCCCAGGCCTGGG - Intronic
1032437155 7:131909598-131909620 CCGAGTCTCCCCCCGCGCCTTGG + Intergenic
1035236078 7:157498366-157498388 CCGAGCGTGGGCCGGGGCCTCGG - Intergenic
1040564838 8:48556155-48556177 CCCAGGGTGCCCCCGTGCCCAGG + Intergenic
1044666709 8:94640344-94640366 ACGAGCGTGCACCCGGGCTCCGG + Intergenic
1046547321 8:115668507-115668529 CCGAGCGGGCCGCGGGGCCGGGG - Intronic
1049353643 8:142177309-142177331 CCAAGGCTGCCCCTGGGCCTGGG + Intergenic
1053129236 9:35605689-35605711 CCGCCCGTGCCCCCCGGCCCCGG - Exonic
1053435194 9:38069366-38069388 GCGAGCCTGGCCCCGGGCCGCGG + Intergenic
1053749019 9:41235093-41235115 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1054254454 9:62799946-62799968 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1058908186 9:109498148-109498170 CCGAGCGCGACCCCGGCCCCCGG + Intronic
1060200424 9:121649128-121649150 CCGAGCATCTCCACGGGCCTGGG - Intronic
1061791447 9:133061325-133061347 CTGGGCATGCCCCAGGGCCTCGG + Intergenic
1061795125 9:133081892-133081914 CTGGGCATGCCCCAGGGCCTTGG + Intronic
1061823303 9:133240524-133240546 TAGAGCCTGCCCCTGGGCCTGGG - Intergenic
1061860353 9:133464767-133464789 CCCTGGGTGTCCCCGGGCCTGGG + Intronic
1062373730 9:136252866-136252888 CCCAGTGAGCCCTCGGGCCTGGG + Intergenic
1062463458 9:136671362-136671384 CGGAGCCTGTACCCGGGCCTGGG - Intronic
1189002839 X:36963857-36963879 CCCAGCGCGCCCCTGTGCCTCGG - Intergenic
1194385128 X:93243095-93243117 CTCAGCTTGCCCCAGGGCCTTGG - Intergenic