ID: 1180952347

View in Genome Browser
Species Human (GRCh38)
Location 22:19726232-19726254
Sequence GGGGCCGTGAGGACGCTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180952344_1180952347 -7 Left 1180952344 22:19726216-19726238 CCGTGAGGACGCTGTCGGGGCCG No data
Right 1180952347 22:19726232-19726254 GGGGCCGTGAGGACGCTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180952347 Original CRISPR GGGGCCGTGAGGACGCTGTC GGG Intergenic