ID: 1180952428

View in Genome Browser
Species Human (GRCh38)
Location 22:19726636-19726658
Sequence CCGCCCCCACAGCGTCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180952428_1180952435 2 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952435 22:19726661-19726683 AGGACGCTGTCGGGGCGGTGAGG No data
1180952428_1180952442 23 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952442 22:19726682-19726704 GGACGCTGTGGGGGCGGTGAGGG No data
1180952428_1180952440 17 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952440 22:19726676-19726698 CGGTGAGGACGCTGTGGGGGCGG No data
1180952428_1180952434 -3 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952434 22:19726656-19726678 CGGTGAGGACGCTGTCGGGGCGG No data
1180952428_1180952433 -6 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952433 22:19726653-19726675 GGGCGGTGAGGACGCTGTCGGGG No data
1180952428_1180952431 -8 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952431 22:19726651-19726673 GGGGGCGGTGAGGACGCTGTCGG No data
1180952428_1180952436 11 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952436 22:19726670-19726692 TCGGGGCGGTGAGGACGCTGTGG No data
1180952428_1180952438 13 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952438 22:19726672-19726694 GGGGCGGTGAGGACGCTGTGGGG No data
1180952428_1180952437 12 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952437 22:19726671-19726693 CGGGGCGGTGAGGACGCTGTGGG No data
1180952428_1180952441 22 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952441 22:19726681-19726703 AGGACGCTGTGGGGGCGGTGAGG No data
1180952428_1180952432 -7 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952432 22:19726652-19726674 GGGGCGGTGAGGACGCTGTCGGG No data
1180952428_1180952439 14 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952439 22:19726673-19726695 GGGCGGTGAGGACGCTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180952428 Original CRISPR CCGCCCCCACAGCGTCCTCA CGG (reversed) Intergenic