ID: 1180952432

View in Genome Browser
Species Human (GRCh38)
Location 22:19726652-19726674
Sequence GGGGCGGTGAGGACGCTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180952428_1180952432 -7 Left 1180952428 22:19726636-19726658 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952432 22:19726652-19726674 GGGGCGGTGAGGACGCTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180952432 Original CRISPR GGGGCGGTGAGGACGCTGTC GGG Intergenic