ID: 1180952462 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:19726772-19726794 |
Sequence | GGGGCGGTGAGGACGCTGTC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180952458_1180952462 | -7 | Left | 1180952458 | 22:19726756-19726778 | CCGTGAGGACGCTGTGGGGGCGG | No data | ||
Right | 1180952462 | 22:19726772-19726794 | GGGGCGGTGAGGACGCTGTCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180952462 | Original CRISPR | GGGGCGGTGAGGACGCTGTC GGG | Intergenic | ||