ID: 1180952462

View in Genome Browser
Species Human (GRCh38)
Location 22:19726772-19726794
Sequence GGGGCGGTGAGGACGCTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180952458_1180952462 -7 Left 1180952458 22:19726756-19726778 CCGTGAGGACGCTGTGGGGGCGG No data
Right 1180952462 22:19726772-19726794 GGGGCGGTGAGGACGCTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180952462 Original CRISPR GGGGCGGTGAGGACGCTGTC GGG Intergenic