ID: 1180953007

View in Genome Browser
Species Human (GRCh38)
Location 22:19729197-19729219
Sequence GTGCCAGGCCACCGCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180953007_1180953013 -2 Left 1180953007 22:19729197-19729219 CCTCCCCAGCGGTGGCCTGGCAC No data
Right 1180953013 22:19729218-19729240 ACCTCCAGAGGTCCTAGTGTAGG No data
1180953007_1180953016 5 Left 1180953007 22:19729197-19729219 CCTCCCCAGCGGTGGCCTGGCAC No data
Right 1180953016 22:19729225-19729247 GAGGTCCTAGTGTAGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180953007 Original CRISPR GTGCCAGGCCACCGCTGGGG AGG (reversed) Intergenic
No off target data available for this crispr