ID: 1180953498

View in Genome Browser
Species Human (GRCh38)
Location 22:19731198-19731220
Sequence TGTGCACACCGCCGCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180953486_1180953498 18 Left 1180953486 22:19731157-19731179 CCGCTGGTGTTTGCTCGGTAAAC No data
Right 1180953498 22:19731198-19731220 TGTGCACACCGCCGCGGGGGAGG No data
1180953484_1180953498 22 Left 1180953484 22:19731153-19731175 CCTCCCGCTGGTGTTTGCTCGGT No data
Right 1180953498 22:19731198-19731220 TGTGCACACCGCCGCGGGGGAGG No data
1180953481_1180953498 24 Left 1180953481 22:19731151-19731173 CCCCTCCCGCTGGTGTTTGCTCG No data
Right 1180953498 22:19731198-19731220 TGTGCACACCGCCGCGGGGGAGG No data
1180953482_1180953498 23 Left 1180953482 22:19731152-19731174 CCCTCCCGCTGGTGTTTGCTCGG No data
Right 1180953498 22:19731198-19731220 TGTGCACACCGCCGCGGGGGAGG No data
1180953485_1180953498 19 Left 1180953485 22:19731156-19731178 CCCGCTGGTGTTTGCTCGGTAAA No data
Right 1180953498 22:19731198-19731220 TGTGCACACCGCCGCGGGGGAGG No data
1180953480_1180953498 25 Left 1180953480 22:19731150-19731172 CCCCCTCCCGCTGGTGTTTGCTC No data
Right 1180953498 22:19731198-19731220 TGTGCACACCGCCGCGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180953498 Original CRISPR TGTGCACACCGCCGCGGGGG AGG Intergenic
No off target data available for this crispr