ID: 1180954375

View in Genome Browser
Species Human (GRCh38)
Location 22:19735094-19735116
Sequence GAGAACATGGGGAGGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180954375_1180954384 6 Left 1180954375 22:19735094-19735116 CCTGCAGTCCTCCCCATGTTCTC No data
Right 1180954384 22:19735123-19735145 GTGGGCTGCTGTACCTGGATTGG No data
1180954375_1180954383 1 Left 1180954375 22:19735094-19735116 CCTGCAGTCCTCCCCATGTTCTC No data
Right 1180954383 22:19735118-19735140 CAGGCGTGGGCTGCTGTACCTGG No data
1180954375_1180954387 24 Left 1180954375 22:19735094-19735116 CCTGCAGTCCTCCCCATGTTCTC No data
Right 1180954387 22:19735141-19735163 ATTGGCCCTAGCAGGTGACTCGG No data
1180954375_1180954385 16 Left 1180954375 22:19735094-19735116 CCTGCAGTCCTCCCCATGTTCTC No data
Right 1180954385 22:19735133-19735155 GTACCTGGATTGGCCCTAGCAGG No data
1180954375_1180954390 29 Left 1180954375 22:19735094-19735116 CCTGCAGTCCTCCCCATGTTCTC No data
Right 1180954390 22:19735146-19735168 CCCTAGCAGGTGACTCGGGCTGG No data
1180954375_1180954388 25 Left 1180954375 22:19735094-19735116 CCTGCAGTCCTCCCCATGTTCTC No data
Right 1180954388 22:19735142-19735164 TTGGCCCTAGCAGGTGACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180954375 Original CRISPR GAGAACATGGGGAGGACTGC AGG (reversed) Intergenic
No off target data available for this crispr