ID: 1180955828

View in Genome Browser
Species Human (GRCh38)
Location 22:19740807-19740829
Sequence TGCCCCCACAAGGCCCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180955828_1180955837 -3 Left 1180955828 22:19740807-19740829 CCCGCCCGGGCCTTGTGGGGGCA No data
Right 1180955837 22:19740827-19740849 GCAGGGCCAGCGAGGAGGAGAGG No data
1180955828_1180955836 -8 Left 1180955828 22:19740807-19740829 CCCGCCCGGGCCTTGTGGGGGCA No data
Right 1180955836 22:19740822-19740844 TGGGGGCAGGGCCAGCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180955828 Original CRISPR TGCCCCCACAAGGCCCGGGC GGG (reversed) Intergenic