ID: 1180962749

View in Genome Browser
Species Human (GRCh38)
Location 22:19769622-19769644
Sequence TCCACAGGAACGGTAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180962749_1180962755 -6 Left 1180962749 22:19769622-19769644 CCAGCCACTACCGTTCCTGTGGA No data
Right 1180962755 22:19769639-19769661 TGTGGAGGTGACGTTCCCATGGG 0: 1
1: 1
2: 2
3: 12
4: 83
1180962749_1180962759 13 Left 1180962749 22:19769622-19769644 CCAGCCACTACCGTTCCTGTGGA No data
Right 1180962759 22:19769658-19769680 TGGGCAGCTGCCCTAAGGCCTGG No data
1180962749_1180962754 -7 Left 1180962749 22:19769622-19769644 CCAGCCACTACCGTTCCTGTGGA No data
Right 1180962754 22:19769638-19769660 CTGTGGAGGTGACGTTCCCATGG 0: 1
1: 1
2: 1
3: 8
4: 144
1180962749_1180962756 8 Left 1180962749 22:19769622-19769644 CCAGCCACTACCGTTCCTGTGGA No data
Right 1180962756 22:19769653-19769675 TCCCATGGGCAGCTGCCCTAAGG 0: 1
1: 0
2: 1
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180962749 Original CRISPR TCCACAGGAACGGTAGTGGC TGG (reversed) Intronic
No off target data available for this crispr