ID: 1180963573

View in Genome Browser
Species Human (GRCh38)
Location 22:19773873-19773895
Sequence ACTGCAGGAGGGAAACTCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180963573_1180963583 1 Left 1180963573 22:19773873-19773895 CCGCCGAGTTTCCCTCCTGCAGT 0: 1
1: 0
2: 1
3: 7
4: 151
Right 1180963583 22:19773897-19773919 GGAGGTTTCCCACGACTGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1180963573_1180963582 0 Left 1180963573 22:19773873-19773895 CCGCCGAGTTTCCCTCCTGCAGT 0: 1
1: 0
2: 1
3: 7
4: 151
Right 1180963582 22:19773896-19773918 GGGAGGTTTCCCACGACTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 86
1180963573_1180963581 -3 Left 1180963573 22:19773873-19773895 CCGCCGAGTTTCCCTCCTGCAGT 0: 1
1: 0
2: 1
3: 7
4: 151
Right 1180963581 22:19773893-19773915 AGTGGGAGGTTTCCCACGACTGG 0: 1
1: 0
2: 1
3: 4
4: 58
1180963573_1180963586 10 Left 1180963573 22:19773873-19773895 CCGCCGAGTTTCCCTCCTGCAGT 0: 1
1: 0
2: 1
3: 7
4: 151
Right 1180963586 22:19773906-19773928 CCACGACTGGAGGGAAGCAGTGG 0: 1
1: 0
2: 1
3: 24
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180963573 Original CRISPR ACTGCAGGAGGGAAACTCGG CGG (reversed) Intronic
900100612 1:960613-960635 ACTGCCGGAGGGCTGCTCGGCGG - Exonic
901061052 1:6472035-6472057 CCTCCTGGAGGGAAGCTCGGGGG + Intronic
903377451 1:22875831-22875853 AGTTCAGGAGGGCATCTCGGAGG + Intronic
905643665 1:39609744-39609766 AGAGCAGAAGGGAGACTCGGTGG + Intergenic
906772597 1:48498641-48498663 ACGGCAGGAGGGGAACACGCGGG - Intergenic
911670921 1:100606622-100606644 CCCGCAGGAGGGAAGCTAGGTGG + Intergenic
913220292 1:116654576-116654598 ACTGCAGGAGGCAAAGTATGAGG + Intronic
913385991 1:118259001-118259023 AAGGCAGGAGGGGCACTCGGGGG + Intergenic
915201425 1:154232507-154232529 ACTGCAAGAGGGAAAGTCTGTGG - Intronic
915270122 1:154747874-154747896 CCAGCATGAGGGAAGCTCGGAGG - Intronic
915646457 1:157276232-157276254 ACTGGAGGAGGGATATGCGGTGG + Intergenic
918964803 1:191329589-191329611 ACTGCAGGGGAGAAAATCTGTGG - Intergenic
921259839 1:213376586-213376608 AGAGCAGGAGGCAAAATCGGAGG - Intergenic
922164123 1:223100786-223100808 ACTTCAGGAGGGACTCTCTGTGG - Intergenic
922853563 1:228755249-228755271 ACTGCATGGGGTAAAGTCGGCGG + Intergenic
1063122791 10:3116307-3116329 ACTGCAGGAGGAGAACCCGTGGG - Intronic
1065049130 10:21772901-21772923 ACGGCAGAAGGCAAACTAGGAGG + Intronic
1065102617 10:22345701-22345723 ACTGCGGGAGAGAGAGTCGGTGG - Exonic
1069176531 10:65296080-65296102 ACTACAGGTGGGAAAAACGGAGG + Intergenic
1073181887 10:101588390-101588412 GCTGCAGGACGGTAACTCGAGGG + Exonic
1074416795 10:113273795-113273817 GCTGCAGGAGGGACAGTCAGAGG + Intergenic
1074419190 10:113294045-113294067 ACTGAAGGAGGGGACCTAGGCGG + Intergenic
1074895384 10:117773060-117773082 ACTGGAGGTGGGAAATTTGGGGG - Intergenic
1076864999 10:133162104-133162126 ACTGCACGCTGCAAACTCGGTGG - Intronic
1077008218 11:369106-369128 ACTGCAGGCGGACAACACGGAGG - Intergenic
1077799710 11:5525513-5525535 AGTGCAGGAGGCAAACTCCTCGG - Intronic
1078730503 11:13969831-13969853 AATGCTGGAGGGAAACTAGAAGG - Intronic
1084381003 11:68812740-68812762 ACTGCAGGCTGTAAACTCTGGGG - Intronic
1084943323 11:72625831-72625853 TCTGCAGGAAGGACACACGGAGG + Intronic
1085035903 11:73299893-73299915 AGGGCAGGAGGGGAACACGGCGG - Intergenic
1085745627 11:79111994-79112016 ACTGCAGGAGGGCAAGGTGGGGG + Intronic
1088314946 11:108498192-108498214 CCTGCAGGCGGTCAACTCGGAGG - Exonic
1090163268 11:124517875-124517897 GCAGCAGCAGGGAAACTCCGTGG + Intergenic
1092781436 12:11991346-11991368 TGTGCAGGAGGCAAACTTGGGGG - Intergenic
1095127831 12:38503066-38503088 ATTGCTGGAGGGAAATTAGGAGG + Intergenic
1096294962 12:50376112-50376134 TCTGGATGAGGGAAACTCAGTGG + Intronic
1099071855 12:78054536-78054558 AATTCAGGGGAGAAACTCGGGGG + Intronic
1101409247 12:104455745-104455767 ACTGCTGGAGGAGAACTCTGGGG + Intronic
1103615099 12:122146865-122146887 ACTGCAGGATGTAAACTCTATGG - Exonic
1103638621 12:122330184-122330206 GATGCAAGAGGGAAACTTGGGGG + Intronic
1103719349 12:122965220-122965242 TCTCCAGGATGGAGACTCGGGGG + Intronic
1104960145 12:132484633-132484655 ACTGCAAGGGGCAGACTCGGGGG + Intergenic
1106714496 13:32373847-32373869 AGTACAGGAGGGAAACCGGGAGG - Intronic
1109493021 13:63128378-63128400 AATGTAGGATGGAAACTCTGTGG + Intergenic
1112262018 13:97885680-97885702 AGTGCAGTGGGGAAACTGGGAGG + Intergenic
1112374639 13:98827726-98827748 ACTGCAAGAGGGACACACGTGGG - Intronic
1114392241 14:22322468-22322490 CCTGCAGGAGGAAAAGTCTGCGG + Intergenic
1119137047 14:72230660-72230682 ACTGCAGGCTGGAAACTCTCAGG + Intronic
1119385751 14:74257375-74257397 ACTGCAGGTGCCAAACCCGGAGG + Intronic
1119539242 14:75428036-75428058 CCTGCGGGAGGGACGCTCGGCGG + Intronic
1120134812 14:80855330-80855352 AAAGCAGGAGGAAAACTCAGAGG - Intronic
1124664804 15:31583174-31583196 ACTGCAGGAGAGAAGCTTGCAGG + Intronic
1128801968 15:70502655-70502677 ACTGCAGGAGGGGACCCAGGGGG - Intergenic
1131087424 15:89588655-89588677 ACTGAAGGAGGGCAACACGCTGG + Intronic
1131352782 15:91717034-91717056 ACTGCTGCAGGGAAACTGGTTGG + Intergenic
1132398676 15:101491414-101491436 TCTGTAGGAGGGACACACGGTGG - Intronic
1132602339 16:778896-778918 ACTGAAGGAGGGAGAGTGGGAGG + Intronic
1134064493 16:11219030-11219052 AGTGCAAGAGGGAAAACCGGAGG + Intergenic
1135912963 16:26578153-26578175 ACTGATGGATGGAAACTGGGAGG - Intergenic
1138244837 16:55459850-55459872 ACTGCAGGAGGGAAGCTGGGTGG - Intronic
1141161327 16:81630871-81630893 ACTGCAGGAGGGGCCCTCAGTGG + Intronic
1141461854 16:84182455-84182477 ACAGCAGGAGGATCACTCGGTGG + Intronic
1141483026 16:84319409-84319431 GCTGCAGGAGGGACACACGCTGG - Exonic
1142547713 17:716003-716025 ACTCCAGGAGGGAAACGCGTTGG + Intronic
1143550484 17:7627541-7627563 ACTGCAGGCCGGTAACCCGGGGG - Intronic
1144186591 17:12802354-12802376 CCTGCAGCAGGGACACTCTGTGG - Intronic
1146373412 17:32279444-32279466 GGAGCAGGAGGGAAACTCAGTGG - Intronic
1151040902 17:70860274-70860296 GCTGCAGGAGGGAAAAAAGGAGG + Intergenic
1151206628 17:72512881-72512903 ACTTCAGGAGGGAAATCCAGGGG + Intergenic
1152028001 17:77824204-77824226 AATGGAGGAGGGTAACTTGGAGG + Intergenic
1152437150 17:80283435-80283457 ACTGCAGGAGAGACCCTTGGAGG - Intronic
1153718687 18:7879192-7879214 ACTGCAGAGAGGAAACCCGGTGG - Intronic
1159176347 18:64840061-64840083 ACTGAAGGAAGGAAAATTGGTGG - Intergenic
1160246594 18:77164802-77164824 ACTGCATGAGTAAAACGCGGTGG - Intergenic
1160532270 18:79572360-79572382 ACAGCAGCAGGGAAACCCGTGGG + Intergenic
1165901040 19:39169510-39169532 CCTGCGGGAGGGAATCACGGTGG - Exonic
1166816711 19:45550688-45550710 AAATCAGGAGGGAAACTGGGAGG - Intronic
1168240506 19:55086692-55086714 TCTGCAGGCGGGAAACCGGGAGG - Exonic
927392951 2:22616158-22616180 ACTGCAGGGAGGAAACCAGGAGG + Intergenic
930144871 2:47991708-47991730 AGTGCAGATGGAAAACTCGGTGG + Intergenic
936875820 2:117187937-117187959 ACTGCAGGAAGCAACCACGGAGG - Intergenic
939354079 2:141078340-141078362 ACTGCAGGACTGAAATTCTGTGG - Intronic
940468538 2:154063841-154063863 CCTGCAGGAAGGAAAATCAGTGG - Intronic
942453526 2:176122947-176122969 ACTACACGAGGCGAACTCGGCGG - Exonic
1168756383 20:321333-321355 ATTGGAGGAGGGAAATTTGGGGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1175357379 20:58379493-58379515 ACTACAGGATGGAAAGTCGGGGG - Intergenic
1175816186 20:61884389-61884411 CCTGCAGGAGGCAAAGTCTGCGG + Intronic
1176015223 20:62927432-62927454 ACTGCAGGAAAGAGACTGGGAGG + Intronic
1176902786 21:14463465-14463487 ACTGTAGCAGGTAAAATCGGTGG + Intergenic
1180963573 22:19773873-19773895 ACTGCAGGAGGGAAACTCGGCGG - Intronic
1182332576 22:29561455-29561477 ATTGCAGCAGGGAAATTGGGGGG + Intronic
950334680 3:12183875-12183897 ACTGGTGGAGGGAAAGTTGGAGG - Intronic
953023360 3:39130185-39130207 ACTGGAGAAGGGAGACTGGGGGG - Intronic
955966230 3:64391958-64391980 ACTGCAGCTGGGAAAGGCGGAGG - Intronic
957240109 3:77648872-77648894 ACTGCAAGAGGAAATCTGGGTGG + Intronic
959306215 3:104670054-104670076 ACTGGAGGTGGGAAACACAGTGG - Intergenic
959613609 3:108322398-108322420 AGTGCAGGAGAGAATCTAGGGGG + Intronic
959667478 3:108937783-108937805 ACAGAAGGAGGGGAACGCGGTGG + Intronic
960573352 3:119206470-119206492 GCTGCAGGAAGGAAACTAGCTGG - Intergenic
962471742 3:135715142-135715164 ACTGCAGGAAGAAAACTAAGGGG + Intergenic
967082231 3:186060893-186060915 TCTGCAGCAGGCAAACTAGGAGG - Intronic
972714216 4:41629749-41629771 ACTGCCAGGGGGAAACTGGGGGG - Intronic
973236970 4:47915565-47915587 TGTGAAGGAGGGAAATTCGGGGG + Intronic
974322527 4:60369551-60369573 AGTGCAGAAGGGAAACGTGGAGG + Intergenic
975922313 4:79407056-79407078 AGTGCAAGAGGGATACTCTGTGG - Exonic
981148933 4:141358779-141358801 ACTTCAGGAGGCCAAGTCGGGGG - Intergenic
982527875 4:156502601-156502623 ACAGCAGAAGGGAAAGTCAGAGG - Intergenic
985620703 5:953448-953470 ACGGCAGGAAGGAAGCACGGAGG + Intergenic
985627201 5:995244-995266 TCTGCAGGAGGAAACCTCAGTGG + Intergenic
988687131 5:33535994-33536016 GCTGCAGGAGGGAGATTCGCTGG + Intronic
989621605 5:43389950-43389972 GCTGCAGGAGGGAACCTCTAGGG - Intronic
990253682 5:53942977-53942999 ACTTCAAGAGGGAAAATGGGAGG + Intronic
990849809 5:60190144-60190166 TCTGCAGGAAGGAAATTAGGAGG + Intronic
992170637 5:74098232-74098254 GCTCCAGGAGGGTAACTCAGAGG - Intergenic
992264608 5:75005959-75005981 AATGCAGAAGGGAAGCTCTGGGG + Intergenic
994125538 5:96166144-96166166 TCTGCAGGGGGGAAACACTGTGG - Intergenic
999409778 5:151340588-151340610 AAGGTAGGAGGGAAACTAGGGGG + Intronic
999572517 5:152936755-152936777 ACCACAGGAAGGAAACTTGGGGG + Intergenic
1001196626 5:169678919-169678941 AATGGAGAAGAGAAACTCGGAGG + Intronic
1001507557 5:172292013-172292035 ACTGGAGGAGGGAGAGTGGGAGG - Intergenic
1002191865 5:177482552-177482574 AGTGCAGGAGGGAGGCTGGGAGG - Intergenic
1003047492 6:2747123-2747145 ACTGCAGGACGGAAGCCAGGAGG + Intronic
1006628093 6:35411894-35411916 ACTGCAGCAGGGAAAGCCAGGGG - Intronic
1007249901 6:40488454-40488476 CCTGCAGGAGGGAGGCTTGGAGG - Intronic
1008940364 6:57039955-57039977 CCTGCAGGAAGGAAGATCGGTGG - Intergenic
1011614619 6:89186452-89186474 AGTGCAGGAGGGGCACTCTGGGG - Intronic
1015843931 6:137498170-137498192 GCTGCTGGAGAGGAACTCGGTGG - Intergenic
1016899911 6:149091222-149091244 CCTGCAGGAGGGAAACAGGGAGG - Intergenic
1018026264 6:159808718-159808740 CCTGCAGCAGGGAAACACAGGGG - Exonic
1020999082 7:15304960-15304982 ATGGCAGGAGGGAAACCCTGGGG - Intronic
1023028527 7:36073560-36073582 ACTGCAGGAGAGAAGGTAGGAGG - Intergenic
1024812068 7:53223616-53223638 CCTGCAGGAGGGACACTGTGGGG - Intergenic
1025986331 7:66455730-66455752 AGTGCAGGAGCCAAACTCTGAGG + Intergenic
1026028599 7:66768932-66768954 AGTGCAGGAGCCAAACTCTGAGG - Intronic
1026984560 7:74546705-74546727 GTGGCAGGAGGGACACTCGGGGG + Intronic
1030407664 7:109134383-109134405 ACTGGAGAAGGGAAAGTAGGAGG + Intergenic
1030981013 7:116185701-116185723 ACTGGATGAGGGAAACGCAGTGG + Intergenic
1033081526 7:138303339-138303361 ACTGGAGGACAGAAACTGGGAGG + Intergenic
1033673627 7:143516479-143516501 AGTGCAGGAGGGAAAATAAGTGG - Intergenic
1035164864 7:156981066-156981088 ACTGCATTAGGGAAAATGGGAGG - Intergenic
1035638306 8:1163451-1163473 CCTGCAGGAAGCAAACTCTGTGG + Intergenic
1038261820 8:26002632-26002654 ACTGCAGGATGGAAATGCGGAGG + Intronic
1041661039 8:60401431-60401453 GCAGCAGGAGGGAGACTCTGAGG + Intergenic
1042788106 8:72572350-72572372 ACAGCAGGAGGCAAAATCTGCGG + Intronic
1047547290 8:125831086-125831108 GTTGCAGGAGGGAAACCAGGAGG - Intergenic
1048407135 8:134135299-134135321 AAGGCAGGAGGGAAATTCGTAGG - Intergenic
1056687384 9:88777941-88777963 ACCCCAGGAGGCAAACTCTGAGG + Intergenic
1056844409 9:90024985-90025007 ACGGCAGGTGTGAAACACGGTGG + Intergenic
1058901774 9:109448272-109448294 ACTGCAGCAGGTAAACTGGTGGG - Intronic
1060360330 9:122949815-122949837 ACTGCAGAAGGGAAAGGGGGAGG + Intronic
1061221649 9:129255472-129255494 ACTGCAAATGGGGAACTCGGGGG + Intergenic
1061453606 9:130681943-130681965 ACAGCAGCAGGGAGACTCGGGGG - Exonic
1188785070 X:34336031-34336053 AGTGCAGAAGGGAAACGCAGGGG - Intergenic
1194677171 X:96807846-96807868 ACTGCAGGAAGGACACTCAGAGG + Intronic
1196292450 X:113959340-113959362 ACTGAAGGAGAGAAACTCAATGG - Intergenic
1198127129 X:133656650-133656672 CCTGGAGGAGGGAAACTTAGGGG + Intronic
1199392512 X:147297144-147297166 CCTGCAAGAGGGAAACACGTTGG + Intergenic
1199420369 X:147637302-147637324 AGTGCAGAAGGGAAACGTGGGGG + Intergenic
1200841134 Y:7782896-7782918 ATTGCAGGAGTGAAACTCTTTGG - Intergenic