ID: 1180964047

View in Genome Browser
Species Human (GRCh38)
Location 22:19776461-19776483
Sequence CAGGGGCCTGCACGGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 757}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180964034_1180964047 21 Left 1180964034 22:19776417-19776439 CCTGCTCTAGAAGAGCTCATGTT 0: 1
1: 0
2: 1
3: 21
4: 331
Right 1180964047 22:19776461-19776483 CAGGGGCCTGCACGGGGTGGAGG 0: 1
1: 0
2: 6
3: 71
4: 757
1180964037_1180964047 -2 Left 1180964037 22:19776440-19776462 CCAGCAGGGACAGCTAACACCCA 0: 1
1: 0
2: 6
3: 26
4: 150
Right 1180964047 22:19776461-19776483 CAGGGGCCTGCACGGGGTGGAGG 0: 1
1: 0
2: 6
3: 71
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180964047 Original CRISPR CAGGGGCCTGCACGGGGTGG AGG Intronic
900002218 1:21011-21033 CTGGGGCCTGAGCCGGGTGGTGG + Intergenic
900556927 1:3285244-3285266 CAGGGGCCTCCACGGGGCTGGGG - Intronic
900803996 1:4755539-4755561 CATGGGCAGGCAGGGGGTGGGGG - Intronic
900949927 1:5852883-5852905 GAGTGGCCTGCATGGGCTGGTGG + Intergenic
900996345 1:6125360-6125382 CAGGGTCCTGCCCCAGGTGGAGG - Intronic
901400982 1:9014991-9015013 CTGGGAGCTGAACGGGGTGGGGG - Intronic
902800024 1:18823589-18823611 CAGAGGCCTGAAGGAGGTGGAGG + Intergenic
903121061 1:21217491-21217513 CCGGGGCCGGCAGGGGGTTGGGG - Intronic
903172463 1:21562777-21562799 CAGGAGCCAGCAAGGGGTTGGGG - Intronic
903594767 1:24485634-24485656 CCGGGGCCTGTCAGGGGTGGGGG - Intergenic
904000517 1:27336024-27336046 GAGCGGACTGCACGGGCTGGAGG - Exonic
904296410 1:29522235-29522257 CAGAGTCATGCACGGGTTGGGGG - Intergenic
904409916 1:30319199-30319221 CAGAGTCATGCACGGGTTGGGGG + Intergenic
904410280 1:30320842-30320864 CAGGGGCATGGAGTGGGTGGGGG + Intergenic
904533289 1:31182641-31182663 CAGGGCCCGGCAGGGGGCGGAGG - Intronic
905885278 1:41488431-41488453 CAGGAGCTTGCAGGGGCTGGGGG + Intergenic
906583453 1:46955547-46955569 AAGGGGCATGGACGAGGTGGTGG - Intergenic
906693583 1:47809419-47809441 CAGGGAGCTGCTCAGGGTGGGGG - Intronic
907518270 1:55007105-55007127 CAGGGGCCAGCAAGGAGCGGTGG - Exonic
908685122 1:66709184-66709206 CTGGGGCCTGTCGGGGGTGGGGG - Intronic
908902181 1:68968439-68968461 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
908939573 1:69415456-69415478 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
909340263 1:74523927-74523949 CTGGGGCCTGTCGGGGGTGGGGG - Intronic
909456561 1:75856441-75856463 CCGGGGCCTGTCGGGGGTGGAGG - Intronic
909780521 1:79540966-79540988 CCGGGGCCTGTTGGGGGTGGGGG - Intergenic
910303955 1:85740537-85740559 CCTGAGCCTGCAGGGGGTGGAGG - Intronic
910751370 1:90634775-90634797 CTGGGGCCTGTTGGGGGTGGTGG - Intergenic
911408104 1:97466927-97466949 TAGGGGCCTGCAGTGGGGGGTGG + Intronic
912164203 1:107022959-107022981 CAGGGCCTGTCACGGGGTGGGGG + Intergenic
912642639 1:111361905-111361927 CAGGGGCATGCAGGAGATGGAGG + Intergenic
912687389 1:111778196-111778218 CAGGGGCGTGGAAGGGGTGGTGG - Intronic
912712242 1:111958311-111958333 CAGGGTCCTGCAGGGTTTGGGGG - Intronic
912880817 1:113412026-113412048 CTGGGGCCTGTCGGGGGTGGGGG - Intronic
913156220 1:116101766-116101788 CCAGGGCCTGCAGGGGGTGGGGG - Intergenic
913319896 1:117580872-117580894 CAGAGGCTGGCACTGGGTGGAGG - Intergenic
914562136 1:148830579-148830601 CTGGGGCCTGTTTGGGGTGGGGG - Intronic
914610694 1:149299643-149299665 CTGGGGCCTGTTTGGGGTGGGGG + Intergenic
915110976 1:153564508-153564530 CAGGGGCATGGATAGGGTGGGGG + Intronic
915443283 1:155960035-155960057 CAGGGGCCTGCTGGGGTTGAAGG - Intronic
915524669 1:156468284-156468306 CAGGGGGCTGCCCGGGCTGGAGG + Exonic
915625373 1:157111240-157111262 CAAGGAGCTGCACAGGGTGGAGG + Intergenic
915913264 1:159927353-159927375 GAGTGGCCTGTTCGGGGTGGGGG + Exonic
916245708 1:162686370-162686392 CAGGGCCTGTCACGGGGTGGGGG - Intronic
916395788 1:164386024-164386046 CCAGGGCCTGCAGGGGGTGGGGG - Intergenic
916555324 1:165889846-165889868 CTGGGGCCTGCTGGAGGTGGCGG - Intronic
916645283 1:166778723-166778745 CTGGGGCCTGTGGGGGGTGGGGG - Intergenic
917019937 1:170575196-170575218 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
917788709 1:178486382-178486404 CTTGGGCCTGCCTGGGGTGGAGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
917974609 1:180230690-180230712 CAGGGGCCGGGAGGGGCTGGCGG + Intronic
918071059 1:181133698-181133720 AAGGGGCCAGCACAAGGTGGTGG - Intergenic
918353223 1:183679390-183679412 CGGGGGCCTGTCGGGGGTGGGGG - Intronic
918791024 1:188829210-188829232 CCGGGGCCTGTTGGGGGTGGGGG - Intergenic
919728633 1:200899457-200899479 TCGGGGCCTGCAAGGGTTGGGGG - Exonic
920073873 1:203322925-203322947 CTGGAGCCTGCTCAGGGTGGAGG + Intergenic
920691905 1:208153755-208153777 CCGGGGACTGCAAGGGATGGAGG - Intronic
920928825 1:210367915-210367937 CTGGAGCCTGCAGGGGGTGGGGG - Intronic
920994063 1:210970268-210970290 CCGGGGCCTGTTGGGGGTGGGGG - Intronic
921618444 1:217299315-217299337 CCGGGGCCTGTCGGGGGTGGGGG - Intergenic
922022445 1:221718119-221718141 GCGGGGGCTGCAGGGGGTGGGGG + Intronic
922398856 1:225229754-225229776 CTGGGGCCTGTCAGGGGTGGGGG + Intronic
923385074 1:233458069-233458091 CAGGGGCTAGCATGGGGTGCAGG - Intergenic
924243073 1:242058190-242058212 CTGGGGCCTGTGGGGGGTGGGGG - Intergenic
924414107 1:243840340-243840362 CCAGGGCCTGCTGGGGGTGGGGG + Intronic
924496637 1:244596596-244596618 CCGGGGCCTGTCTGGGGTGGGGG + Intronic
1063798413 10:9540343-9540365 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
1064236116 10:13577385-13577407 CCGGGGCCTGCAGGGGGTGGAGG - Intergenic
1064462964 10:15552688-15552710 CCGGGGCCTGCCCGGGGGTGAGG - Intronic
1064559107 10:16578207-16578229 AAGGGTTCTGCACTGGGTGGAGG - Intergenic
1065275598 10:24082400-24082422 CTGGGGCCTGTTAGGGGTGGGGG - Intronic
1066148221 10:32585528-32585550 CAGGGGCCTGTCAGGGGTGGGGG - Intronic
1067567752 10:47350627-47350649 GAGGGGACAGCAGGGGGTGGTGG - Exonic
1068147131 10:53086474-53086496 CCAGGGCCTGTATGGGGTGGGGG - Intergenic
1069562783 10:69442347-69442369 TAGGGTCCTGCATGGGGTGATGG - Intergenic
1070174195 10:73956507-73956529 CAGGGGCCAGCTCCTGGTGGAGG - Intergenic
1070320956 10:75354166-75354188 CAGGTGGCTGCAAGTGGTGGTGG + Intergenic
1070610024 10:77926649-77926671 CCGGGGCCTGGGCGGGCTGGGGG + Intergenic
1071253548 10:83845223-83845245 CAGGGGCCTGTTGGGGGTGGGGG - Intergenic
1071515375 10:86293355-86293377 CAGGGGCCTGAGCAGTGTGGGGG - Intronic
1071668448 10:87584134-87584156 CTGGGGCCTGCTGGGGGTGATGG - Intergenic
1071976700 10:90962947-90962969 CTGGGGCCTGTCAGGGGTGGGGG - Intergenic
1072429693 10:95359890-95359912 CAGGGGACTGCCGAGGGTGGGGG + Intronic
1072929777 10:99652204-99652226 CAAAGTCCTGCATGGGGTGGAGG + Intergenic
1073041762 10:100612678-100612700 CCAGGGCCTCCAAGGGGTGGGGG + Intergenic
1073186425 10:101617989-101618011 CAGGCCCCTGCACAAGGTGGGGG + Intronic
1073289972 10:102408748-102408770 CAGAGGCGGGCACGGGCTGGGGG - Intronic
1074016221 10:109536772-109536794 CTGGGGCCTGTCCAGGGTGGGGG - Intergenic
1074083333 10:110185597-110185619 CTGGGGCCTGTCAGGGGTGGGGG - Intergenic
1075091724 10:119447553-119447575 CAGGGAGCTGCACGGGGAAGAGG - Intronic
1075504411 10:123009227-123009249 CAGAGGCCTGAAGGGGGTCGGGG - Intronic
1075747297 10:124736678-124736700 GGGTGGCCTCCACGGGGTGGGGG + Intronic
1076204156 10:128581925-128581947 CAGGGGCCTGCAGGGGCCTGTGG - Intergenic
1076236950 10:128870979-128871001 CCAGGGCCTGCATGGGGTAGGGG - Intergenic
1076402933 10:130195195-130195217 CAGGGGCCTGCAGTGGATGGAGG + Intergenic
1076450213 10:130551916-130551938 CAGGGCACTGCGCGGTGTGGTGG + Intergenic
1076683331 10:132186284-132186306 CAGGGACCGGGACGCGGTGGTGG - Intergenic
1076821546 10:132942357-132942379 CCGGGGCCTCCCCGGGGCGGGGG + Intronic
1076821565 10:132942392-132942414 CCGGGGCCTCCCCGGGGCGGGGG + Intronic
1076843150 10:133056424-133056446 GAGAAGCCTGCAGGGGGTGGAGG + Intergenic
1076846850 10:133073377-133073399 CAAATGCCTGCACGGGGTGTGGG - Intronic
1076903494 10:133351258-133351280 GAGGTGGCTGCAGGGGGTGGGGG - Intronic
1076903503 10:133351277-133351299 CCTGGGGCTGCATGGGGTGGAGG - Intronic
1077144130 11:1037195-1037217 CAGGGCCCTTCAGGGGGTGCTGG - Intergenic
1077254335 11:1573640-1573662 CAGTGGCCCGTATGGGGTGGGGG + Intergenic
1077286481 11:1768201-1768223 CAGGGGCAAGCAAGGGCTGGAGG + Intergenic
1077321588 11:1945312-1945334 CAATGGTCTGCACGGGGTTGAGG - Intergenic
1077423887 11:2465575-2465597 GAGGGGCCAGCACGGGGCAGGGG - Intronic
1077776373 11:5276401-5276423 CTGGGGCCTGTTGGGGGTGGGGG + Intronic
1078105938 11:8358008-8358030 CAGGAGCCTGTATGGGGAGGCGG - Intergenic
1078284395 11:9936789-9936811 CTGGGGCCTGTCAGGGGTGGGGG + Intronic
1078998913 11:16733565-16733587 CCGGGGCCTGTTGGGGGTGGGGG + Intronic
1079254931 11:18819558-18819580 AAGGGGCATGGACGAGGTGGCGG + Intergenic
1079271323 11:18988884-18988906 CAGGGGCCTGTAGGGGGTGGGGG - Intergenic
1079578361 11:22030921-22030943 CTGGGGCCTGCAGGGTGTGGGGG + Intergenic
1079863551 11:25705904-25705926 CTGGGGCCTGTTGGGGGTGGAGG - Intergenic
1080737236 11:35028358-35028380 CAGGGGCCTGTGGGGCGTGGGGG + Intergenic
1080844286 11:36013461-36013483 CAGGGGCCTGTAGGGGGGTGGGG - Intronic
1080848346 11:36045967-36045989 CTGGGGCCTGTTGGGGGTGGGGG - Intronic
1081190633 11:40099934-40099956 CAGGGAGCTACGCGGGGTGGAGG - Intergenic
1082166134 11:48953836-48953858 CTGGGGCCTGTCTGGGGTGGGGG - Intergenic
1082237063 11:49831131-49831153 CTGGGGCCTGTCTGGGGTGGGGG + Intergenic
1082241631 11:49878573-49878595 CTGGGGCCTGTCTGGGGTGGGGG - Intergenic
1082637788 11:55617667-55617689 CAGAGGCCTACGGGGGGTGGGGG + Intergenic
1083507558 11:63173205-63173227 CTGGGGCCTGTTGGGGGTGGGGG + Intronic
1083745408 11:64733447-64733469 CTGGGGCCTGCAGGAGGTGGAGG + Intronic
1084760525 11:71267900-71267922 CAGGGGCCTGCCCTGGGTGGTGG - Intergenic
1085386345 11:76160377-76160399 CAGAGGCCAGCAGGGGCTGGGGG + Intergenic
1085683228 11:78597592-78597614 CCGGGGCCTGTTTGGGGTGGGGG - Intergenic
1085755454 11:79197913-79197935 CAGTGGCCTGCACGGCCTGCAGG - Intronic
1085884970 11:80511069-80511091 CTGGGGCCTGCCTGGGGTGGGGG + Intergenic
1086427256 11:86697425-86697447 CAGGGGTCTGCACAGGGTGCTGG - Intergenic
1087353813 11:97068833-97068855 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
1087588513 11:100154109-100154131 CAGGGGCTTGTTCGGGGTTGGGG - Intronic
1087618304 11:100514054-100514076 CAGGGCCTTTCATGGGGTGGAGG - Intergenic
1087710542 11:101544717-101544739 CTGGGGCCTGTTGGGGGTGGCGG + Intronic
1088342075 11:108779523-108779545 CTGGGGCCTGCCGGGGGTGGTGG + Intronic
1088961750 11:114674057-114674079 AAGGGGCCTCCAGGGGCTGGTGG + Intergenic
1088976241 11:114818662-114818684 AAGGGGCCTGGGCAGGGTGGAGG - Intergenic
1089433107 11:118438067-118438089 CTGGGGCTTGGAAGGGGTGGGGG + Intronic
1089562392 11:119350570-119350592 CAGGGGCCAGCTCAGGGTTGGGG + Intergenic
1090258924 11:125304703-125304725 CAGGGGTCTGCACAGGATGCAGG + Intronic
1090262358 11:125330768-125330790 CCGGGAGCTGCAAGGGGTGGTGG - Intronic
1090653255 11:128824695-128824717 CAGGGGGCAGCTCCGGGTGGGGG + Intergenic
1091066471 11:132518230-132518252 CTGGGGCCTGTCGGGGGTGGGGG - Intronic
1202804606 11_KI270721v1_random:625-647 CAATGGTCTGCACGGGGTTGAGG - Intergenic
1091473855 12:753189-753211 CAGGGGCCGGCACCGAGTCGAGG - Exonic
1092111918 12:5970251-5970273 CAGGGGTCAGCGGGGGGTGGTGG - Intronic
1092513834 12:9186838-9186860 CTGGGGCCTGTCGGGGGTGGGGG + Intronic
1092524439 12:9301210-9301232 CACGGGCATGCACAGCGTGGAGG + Intergenic
1093209291 12:16288572-16288594 CAGGGACCTGCAGGAGTTGGGGG + Intergenic
1094134869 12:27114381-27114403 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
1094510191 12:31091835-31091857 CACGGGCATGCACAGCGTGGAGG + Exonic
1094721352 12:33067773-33067795 CAGGGGCCTGTGGGGGATGGGGG - Intergenic
1094785562 12:33844907-33844929 TGGGGGCCTGTAGGGGGTGGAGG - Intergenic
1095140971 12:38661445-38661467 CTGGGGCCTGTTGGGGGTGGGGG + Intronic
1095551723 12:43449471-43449493 CTGGGGCCTGCTGAGGGTGGAGG + Intronic
1095649828 12:44594128-44594150 CCGGGGCCTGTTGGGGGTGGCGG + Intronic
1095964619 12:47858543-47858565 CAGAAGCCTGCAGGTGGTGGTGG - Intronic
1096513728 12:52145450-52145472 CTGGGGCCGGCAGTGGGTGGGGG - Intergenic
1096771802 12:53939915-53939937 CTGGAGCCTGCAAGGGGAGGCGG - Intronic
1097221736 12:57455180-57455202 CAGGCCCCTGCAGGGGGTGGAGG - Intronic
1097584173 12:61495294-61495316 CCGGGGCCTGTCGGGGGTGGGGG - Intergenic
1098106467 12:67072628-67072650 CCGGGGCCTGTCGGGGGTGGGGG + Intergenic
1098151306 12:67549868-67549890 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
1099275414 12:80569740-80569762 CTGGGGCCTGTCGGGGGTGGGGG - Intronic
1099431442 12:82591149-82591171 CTGGGGCCTGTTGGGGGTGGAGG + Intergenic
1099698655 12:86056387-86056409 CTGGGGCCTTAAGGGGGTGGAGG - Intronic
1099892141 12:88602957-88602979 CCGGGGCCTGCAGGGGGGTGGGG - Intergenic
1100054007 12:90487318-90487340 CCGGGGCCTGTCGGGGGTGGGGG - Intergenic
1100317202 12:93455270-93455292 CCGGGGCCTGTCGGGGGTGGGGG - Intergenic
1101075340 12:101123474-101123496 AAGGGGCCTGTTGGGGGTGGGGG - Intronic
1101448619 12:104756212-104756234 CAGAGACCTTCACGGAGTGGTGG - Intronic
1101691373 12:107085647-107085669 CCGGGGCCTGCCAGGGGTTGAGG + Intronic
1102049208 12:109850074-109850096 CTGGGGCCTGTCAGGGGTGGTGG - Intergenic
1102278466 12:111599765-111599787 CTGGGGCCTGCCTGGTGTGGAGG + Intergenic
1102347503 12:112169227-112169249 CAGGGCCCTTCCCGGGGAGGGGG + Intronic
1102472610 12:113168085-113168107 GCGGGGCCTGGCCGGGGTGGGGG - Intronic
1103527657 12:121578771-121578793 CAGAGGGCGGCCCGGGGTGGGGG + Intronic
1103903264 12:124314531-124314553 CTGGGGCCGGCCCGGGGTGCTGG + Exonic
1103932999 12:124460465-124460487 CAGGGCCCAGCACAGGGTTGAGG + Intronic
1104150254 12:126075318-126075340 CAGGGGCTGTCAAGGGGTGGGGG - Intergenic
1104417298 12:128606068-128606090 CAGGAGCCTGCTTGGGCTGGGGG + Intronic
1104989589 12:132618412-132618434 AACCGGCCTGGACGGGGTGGGGG + Intergenic
1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG + Exonic
1105034271 12:132907651-132907673 CCGGGGCCTGTCGGGGGTGGGGG - Intronic
1105058981 12:133130370-133130392 CAGGGTCCGGCACAGAGTGGCGG + Exonic
1106057762 13:26254422-26254444 CAGAGGCCGGCCGGGGGTGGAGG - Exonic
1106101447 13:26697408-26697430 CAGGAGCATGCACGGGGTACTGG + Intergenic
1107624415 13:42268488-42268510 CCGGGGCCTGTAGGGGGTTGGGG - Intergenic
1108015285 13:46068695-46068717 CCGGGGCCTGTCGGGGGTGGGGG - Intronic
1108099835 13:46943056-46943078 CAGGGCCTCTCACGGGGTGGGGG + Intergenic
1108164946 13:47683106-47683128 CAGGGCCTGTCACGGGGTGGGGG - Intergenic
1108173426 13:47767689-47767711 CTGGGGCCTGTTTGGGGTGGGGG - Intergenic
1108600429 13:51988893-51988915 CTGGGGCCTGTCGGGGGTGGGGG + Intronic
1109572487 13:64211213-64211235 CAGGGCCTTTCATGGGGTGGGGG - Intergenic
1110328364 13:74243109-74243131 CCGGGGCCTGTCAGGGGTGGGGG - Intergenic
1110358683 13:74599765-74599787 CAGGGGCCTGTCAGGGGTAGGGG - Intergenic
1110656513 13:78006298-78006320 CTGGGGCCTGTAGGGGGTTGGGG + Intergenic
1110829754 13:80017504-80017526 CTGGGGCTTGCTGGGGGTGGGGG + Intergenic
1111391848 13:87606564-87606586 CAGGGGCCTGTTGGGGGTTGGGG + Intergenic
1111835841 13:93387328-93387350 CTGGGGCCTGTTGGGGGTGGAGG - Intronic
1111905516 13:94251289-94251311 CAGGGCCAGGCAGGGGGTGGGGG + Intronic
1114631420 14:24161675-24161697 CTGGGGCCGGCAGGGGGTGGGGG + Intronic
1114656169 14:24316785-24316807 CAGGGGCGTGGAGGGCGTGGAGG + Exonic
1114742118 14:25108194-25108216 CTGGGGCCTGTCAGGGGTGGGGG + Intergenic
1115973841 14:38975345-38975367 CAGGGGCATGTCAGGGGTGGTGG - Intergenic
1116553090 14:46267276-46267298 CCGGGGCCTGTCGGGGGTGGGGG + Intergenic
1116554279 14:46283790-46283812 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
1117452592 14:55865587-55865609 GAGGGGACTGCCGGGGGTGGTGG + Intergenic
1117631438 14:57696905-57696927 CCGGGGCCTGTCCGGGGTTGTGG + Intronic
1117690131 14:58298166-58298188 CAGGGGCTTGCACGGGGGCGGGG - Intergenic
1117722035 14:58637885-58637907 GAGGGGCCGGCGCGGGGAGGCGG + Intronic
1118303958 14:64639059-64639081 CTGGGGAGTGCAGGGGGTGGGGG + Intergenic
1118373348 14:65156528-65156550 CGTGGGCCTGCACGGGTTTGGGG - Intergenic
1118495084 14:66300445-66300467 CTGGGGCCTGTCAGGGGTGGGGG + Intergenic
1118721714 14:68599164-68599186 CAGGGGGCTGCCAGGAGTGGTGG + Intronic
1119664973 14:76478879-76478901 AAGGGGCTTGCAGGGGGTGAGGG + Intronic
1120430864 14:84413038-84413060 CTGGGGCCTGCCGGGGGTTGGGG - Intergenic
1120548099 14:85834663-85834685 CTGGGGCCTGTGTGGGGTGGGGG + Intergenic
1121161162 14:91742451-91742473 CAGAGGCTTGTAGGGGGTGGTGG + Intronic
1121232967 14:92371987-92372009 CAGAGCCCAGCACAGGGTGGTGG - Intronic
1121259512 14:92555928-92555950 CAGGATCCTGCACCGGGTGGTGG + Exonic
1121725087 14:96141468-96141490 CATGGCCCTGCATGGTGTGGCGG - Intergenic
1122183300 14:99971334-99971356 GAGGGGCGTGGCCGGGGTGGGGG - Intergenic
1122284428 14:100642286-100642308 CAGGGGCCGGCTCAAGGTGGAGG + Intergenic
1122402225 14:101474246-101474268 CAAGGACCTGGACGGGGAGGGGG + Intergenic
1122739479 14:103863381-103863403 GAGGAGGCTGCATGGGGTGGAGG - Intergenic
1122830423 14:104393085-104393107 CTGGGGCCAGCACTGTGTGGGGG + Intergenic
1122885215 14:104707696-104707718 CAGGAGCCTGGCAGGGGTGGTGG - Exonic
1122937610 14:104967237-104967259 CAGGAGCCTGGATGGGTTGGGGG + Intronic
1123786627 15:23681329-23681351 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
1123995133 15:25713112-25713134 CAGGGAACTGAACTGGGTGGAGG - Intronic
1124895475 15:33772652-33772674 CAGGGGGCTGGAGGAGGTGGTGG - Intronic
1124908116 15:33891385-33891407 CAGGGCCCGTCAGGGGGTGGGGG - Intronic
1125211924 15:37226764-37226786 CCGGGGCCTGTCAGGGGTGGGGG + Intergenic
1125880026 15:43185638-43185660 CAGGGGCGGGCTCGGGGTCGGGG + Intronic
1126891142 15:53205652-53205674 CCGGGGCCTGATGGGGGTGGCGG - Intergenic
1127030606 15:54857405-54857427 CAGGGGCCTGTTGGGGGTTGTGG + Intergenic
1127469435 15:59277093-59277115 CACTGCCCTGTACGGGGTGGGGG - Intronic
1127751361 15:62048254-62048276 CAGGGGCCTGTTGGGGGGGGTGG - Intronic
1128081263 15:64858267-64858289 CAGGGCCCTGCATGAGGAGGAGG + Intronic
1128148215 15:65344509-65344531 CAGGGGCCTGGATGGGGGAGAGG + Intronic
1128315555 15:66657232-66657254 CAGGAGGCTGCACGGAGGGGAGG - Intronic
1128339517 15:66810868-66810890 CAGGGCCCGTCATGGGGTGGGGG - Intergenic
1128358467 15:66944306-66944328 CAGGTGCCTCCACAGGGTCGCGG + Intergenic
1129111966 15:73342415-73342437 CAGAGGCCTGCCCGGGCTGCTGG + Intronic
1129423743 15:75450863-75450885 CCGGGGCCTGGGCGGGGTGCAGG + Intronic
1129670705 15:77606248-77606270 CAGGAGACTGCATGGCGTGGAGG + Intergenic
1130053706 15:80504894-80504916 CAGGGGCCTGCGTGGAGTGGTGG + Intronic
1130105446 15:80925408-80925430 GAGGAGCCTGCATGGGCTGGTGG + Intronic
1131858404 15:96624911-96624933 CAGGGGACTGCAGGGAATGGTGG - Intergenic
1131943493 15:97593245-97593267 CAGGGCCTGTCACGGGGTGGGGG + Intergenic
1132451292 15:101969928-101969950 CTGGGGCCTGAGCTGGGTGGTGG - Intergenic
1132581380 16:686227-686249 GAGGGACCTGCATGGGGTGCTGG - Intronic
1132582958 16:693822-693844 CTGGGCCCTGCCCGGGATGGGGG + Exonic
1132862821 16:2079867-2079889 GAGGGGCCTGCTCTGGGTGCTGG + Intronic
1132897800 16:2237186-2237208 CAGGGGCCCGCTCAGGGTCGGGG - Intronic
1132954628 16:2585159-2585181 CAGGGGCCTGCACAGGTATGCGG - Intronic
1133431153 16:5738009-5738031 CTGGTGCCTGGAGGGGGTGGGGG - Intergenic
1133492341 16:6282540-6282562 CTGGGGCCTGTCGGGGGTGGTGG - Intronic
1133598926 16:7320232-7320254 CTGGGGCCTGTAGGGGGTGGTGG - Intronic
1133628457 16:7594128-7594150 CAGGGCCTGTCACGGGGTGGGGG - Intronic
1133899823 16:9963435-9963457 CTGGGGCCTGTCAGGGGTGGGGG - Intronic
1135111154 16:19691747-19691769 CAGAGGCATGCAGGTGGTGGTGG - Intronic
1135537081 16:23302601-23302623 CTGGGGACTGAACGGGTTGGGGG + Intronic
1135759884 16:25128894-25128916 CTGGGGCCTGTCAGGGGTGGGGG + Intronic
1136546665 16:30958403-30958425 GCGGGGCCTGCAGGGGGCGGGGG + Intronic
1136708940 16:32217348-32217370 CTGGGGCCTGTGGGGGGTGGGGG + Intergenic
1136758969 16:32712076-32712098 CTGGGGCCTGTGGGGGGTGGGGG - Intergenic
1136809138 16:33158308-33158330 CTGGGGCCTGTGGGGGGTGGGGG + Intergenic
1136815614 16:33268388-33268410 CTGGGGCCTGTGGGGGGTGGGGG + Intronic
1136990921 16:35151038-35151060 CTGGGGCCTGCTCAGGGAGGGGG - Intergenic
1137252097 16:46747989-46748011 GCGGGGCCTGCACAGGCTGGAGG - Exonic
1137730003 16:50682373-50682395 CTGGGGCCTGTCAGGGGTGGGGG - Intergenic
1138103949 16:54277041-54277063 CAGTGGCCTGCGCAGAGTGGAGG - Intergenic
1139365029 16:66427638-66427660 CAGTGGCCAGCCCGGGGTCGAGG - Intronic
1139385648 16:66567310-66567332 CTGGGGCCTGTAGGGAGTGGGGG - Intronic
1140406220 16:74713415-74713437 TAGGGGCCTGAGCGGGGTGGAGG + Exonic
1140412401 16:74748933-74748955 CCTGGGCCTCCATGGGGTGGGGG - Intronic
1140456951 16:75111251-75111273 CTGGGACCTGCAGGGGATGGAGG + Intergenic
1140653701 16:77117577-77117599 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
1141119914 16:81345583-81345605 CTGGGGCCTGTTAGGGGTGGGGG + Intronic
1141162190 16:81636848-81636870 CACGGGGCTTCAGGGGGTGGGGG - Intronic
1142028528 16:87827097-87827119 CAGGAACCTTCCCGGGGTGGGGG + Intergenic
1142178026 16:88653897-88653919 CAGGGGCCTGCCCTGTGGGGTGG - Intronic
1142250291 16:88988883-88988905 CAGGGGTCAGCACTGGGTGATGG + Intergenic
1142276469 16:89121377-89121399 CGGGGCCCTGCACGCGGAGGTGG + Intronic
1203061125 16_KI270728v1_random:972401-972423 CTGGGGCCTGTGGGGGGTGGGGG - Intergenic
1143200713 17:5111497-5111519 CAGGTGCCCGCCCGGGGAGGGGG + Intronic
1143223349 17:5280786-5280808 CCGGGGCCTGTGGGGGGTGGGGG - Intergenic
1143283046 17:5769091-5769113 CCGGGGCCTGTCGGGGGTGGTGG + Intergenic
1143797129 17:9346137-9346159 CAGGGGCCGGCCGGGCGTGGTGG - Intronic
1143825424 17:9602278-9602300 CCGGGGCCTGTCAGGGGTGGGGG - Intronic
1144782290 17:17814208-17814230 CAGGGGCCTGGCAGGGCTGGGGG - Intronic
1144948520 17:18981955-18981977 CAGGAGCCTGCAGGAGGCGGTGG - Intronic
1145388345 17:22435345-22435367 CAGGGGGCGGGACGGGGCGGAGG - Intergenic
1145871486 17:28277136-28277158 CAGGGGCCTGCCCGCAGTGATGG - Intergenic
1146233003 17:31130567-31130589 CAGTGGCCGGTAAGGGGTGGGGG + Intronic
1146280032 17:31538774-31538796 CCAGGGCCTGCACTGGGAGGTGG - Intergenic
1146475833 17:33162184-33162206 AAGGGGCAGGCATGGGGTGGAGG - Intronic
1146507621 17:33418940-33418962 CCGGGGCCTGTCAGGGGTGGGGG + Intronic
1146890898 17:36505919-36505941 CAGGTGCCTCCTCGAGGTGGTGG + Intronic
1147575474 17:41596448-41596470 CAAGGGCCTGGCCAGGGTGGAGG + Intergenic
1148107775 17:45128438-45128460 CAGGTGCCTGGCCTGGGTGGTGG - Intronic
1148554379 17:48569487-48569509 CAGGGGCGTCTAGGGGGTGGGGG + Intronic
1148587349 17:48790486-48790508 CAGGAGCCTGGCCAGGGTGGAGG + Intronic
1148866809 17:50633045-50633067 CAGGGTCATGGAAGGGGTGGAGG + Intergenic
1148938266 17:51182660-51182682 CAGATGCCTGCAGGGGCTGGTGG - Intronic
1149212778 17:54322654-54322676 CCGGGGCCTGTCAGGGGTGGGGG + Intergenic
1149253780 17:54801020-54801042 CTGGAGCCTGCAGTGGGTGGGGG + Intergenic
1150138404 17:62708686-62708708 AAGTGGCCTGCATGGGTTGGGGG - Intronic
1150336424 17:64333855-64333877 GAGGGGCCTGCCTGGGGAGGTGG + Intronic
1151263125 17:72932445-72932467 CCGGGGCCTGTGGGGGGTGGGGG - Intronic
1151328596 17:73393754-73393776 CAGGGCCCAGCACAGGGTGAGGG + Intronic
1151619954 17:75239505-75239527 GAGGGGCCTGGCTGGGGTGGTGG + Exonic
1151656547 17:75498896-75498918 CAGCAGCCTGCAGGAGGTGGCGG - Exonic
1151715023 17:75826947-75826969 CAGGGGCCTCCCAGGGGTGCAGG - Intergenic
1151941608 17:77295790-77295812 AAGGGGCCTCCGTGGGGTGGGGG - Intronic
1152106290 17:78331066-78331088 CAGGAGCCGGCACGTGGTAGTGG - Intergenic
1152404365 17:80087995-80088017 CAGAGGCCTGCATGGGGGAGGGG - Exonic
1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG + Intergenic
1152610789 17:81314183-81314205 CAGGGGCATGCAAAGGGTGGGGG - Intronic
1152741428 17:82020118-82020140 CAGGGCCCTGCACAGGGTCTGGG + Intronic
1152790056 17:82273850-82273872 CAGGAGCCTGCACGTGGAAGGGG - Intergenic
1153981314 18:10313050-10313072 CCTGGGGCTGGACGGGGTGGTGG - Intergenic
1154001442 18:10485551-10485573 CATCGGCCTGCACGGGGAGTGGG + Exonic
1155190776 18:23428006-23428028 CAGGGGCCTGCCATGGGTTGGGG + Intronic
1155633732 18:27925706-27925728 CCAGGGCCTGCCGGGGGTGGGGG - Intergenic
1156834520 18:41536663-41536685 CAGGGGCCTGTCAGGGGTTGCGG - Intergenic
1157061233 18:44292923-44292945 CAGGAGCCTGCAAGGGGTGGGGG + Intergenic
1157371557 18:47117499-47117521 GAAGGGCCTGCACTGGGTGAAGG - Intronic
1157555572 18:48610835-48610857 CAGGGCTTTGCACAGGGTGGGGG + Intronic
1157613856 18:48975724-48975746 CAGGGACCCTCCCGGGGTGGGGG + Intergenic
1157728456 18:49983552-49983574 CAGGGGCCGGGATGGGGTGGTGG - Intronic
1157901979 18:51526716-51526738 CAGGGGCCTGCAGGTGGTCCTGG - Intergenic
1158470914 18:57735977-57735999 CTGGGGCCTGTTGGGGGTGGGGG - Intronic
1158960466 18:62583867-62583889 CAGGTGTCAGCTCGGGGTGGAGG + Intronic
1159845243 18:73451245-73451267 CAGGGCCTGTCACGGGGTGGAGG - Intergenic
1160072332 18:75639876-75639898 GAGTGGCCAGCAAGGGGTGGTGG + Intergenic
1160077745 18:75694150-75694172 CAGGAGCCGGCAGAGGGTGGGGG - Intergenic
1160117195 18:76090404-76090426 CTGGGGCCTCCATGGGGAGGAGG + Intergenic
1160147916 18:76379346-76379368 CCGGTGCCTGCCCCGGGTGGCGG - Exonic
1160192452 18:76725139-76725161 CAGGGGCCTGTCAGGGGTTGGGG + Intergenic
1160241191 18:77124442-77124464 AGGAGGCCAGCACGGGGTGGGGG - Intronic
1160536733 18:79598436-79598458 CTGGAGCCTGCAGGAGGTGGGGG - Intergenic
1160633971 19:62619-62641 CTGGGGCCTGAGCCGGGTGGTGG + Intergenic
1160889472 19:1369580-1369602 CCGCAGCCTGCAGGGGGTGGAGG - Exonic
1161039168 19:2100825-2100847 CCGAGGCCACCACGGGGTGGGGG + Intergenic
1161339973 19:3736066-3736088 CTGAGGCCTGGAGGGGGTGGGGG + Intronic
1161376121 19:3939884-3939906 CAGGGGCCTGGGCGGAGTGGGGG - Exonic
1161393471 19:4032990-4033012 CAGGGGCCTGTTCTGGGAGGTGG + Intronic
1161429718 19:4224551-4224573 AAGGGGCCTGCAGGGGGGTGAGG - Exonic
1161931682 19:7344866-7344888 CTGCGGGCTGGACGGGGTGGTGG + Intergenic
1162822464 19:13231370-13231392 CAGGTGCCCCCAGGGGGTGGGGG - Intronic
1163482068 19:17562730-17562752 GACAGGCCTGCATGGGGTGGGGG + Intronic
1163817010 19:19472742-19472764 CTTGGGCCTGCATGGGGTGAGGG + Intronic
1163821827 19:19500383-19500405 CAGAGGACTGCAGGGGCTGGGGG - Intronic
1164537777 19:29099197-29099219 CGGGGCACTGCAGGGGGTGGTGG - Intergenic
1164986732 19:32653732-32653754 CGGGGGCGGGGACGGGGTGGGGG + Intronic
1165003208 19:32782120-32782142 CTGGGGCCTGTGGGGGGTGGGGG - Intronic
1165449068 19:35871863-35871885 CGGGGGCCAGGACCGGGTGGAGG - Exonic
1165934677 19:39382019-39382041 CAGTGGCCAGCACCGTGTGGAGG - Intronic
1166026817 19:40094576-40094598 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
1166144194 19:40823098-40823120 CAGGGACATGCAAGGGATGGAGG - Intronic
1167078000 19:47260637-47260659 CAGGGGCCAGCAAGGGGGGCCGG + Exonic
1167278685 19:48553943-48553965 CAGGTGCCTGGCTGGGGTGGGGG - Intronic
1167299580 19:48671094-48671116 AGGGGGCCTGGACGGGTTGGGGG - Intronic
1167397282 19:49238906-49238928 CTGGGGCCTGTCAGGGGTGGGGG - Intergenic
1167506382 19:49873165-49873187 CAGGGGCCCGGGCGGGGTGGTGG + Exonic
1167955099 19:53058027-53058049 CAGGGCCCGGCACGAGGAGGAGG + Intergenic
1167960751 19:53102892-53102914 CAGGGCCCGGCACGAGGAGGAGG + Intronic
1167967313 19:53158242-53158264 CAGGGCCCGGCACGAGGAGGAGG + Intronic
1167971862 19:53192841-53192863 CAGGGCCCGGCACGAGGAGGAGG + Intronic
1168289985 19:55352915-55352937 CAGCGGCCTCTGCGGGGTGGGGG + Intronic
1168489367 19:56795390-56795412 CAGGGGCCTGGGCGGGGCTGGGG - Intronic
1168543385 19:57231165-57231187 CAGGGTCCTGAAAGGGGTGGGGG - Exonic
1168652083 19:58097890-58097912 CACGAGCCTACACGGGGTGGGGG + Intronic
924989527 2:300515-300537 CTGGGGCCTGTCGGGGGTGGTGG + Intergenic
925155813 2:1648404-1648426 CAGGGGGCTGTTCGGGGTGGCGG - Exonic
926055497 2:9771611-9771633 GGAGGGCCTGCACGGGGCGGGGG + Intergenic
926123874 2:10259441-10259463 CTGTGGCCTGGAAGGGGTGGTGG + Intergenic
926198589 2:10777983-10778005 CAGGGCCCTGGCTGGGGTGGTGG + Intronic
926297203 2:11577580-11577602 CAGCGGCCTGCCATGGGTGGAGG + Intronic
927117800 2:19922555-19922577 CCGGGGCCTGTAGGGGGTGGGGG + Intronic
927292660 2:21420053-21420075 GAGGGCCCTGCAGTGGGTGGTGG - Intergenic
927680013 2:25132887-25132909 AAGGAGCCTGCAGGAGGTGGCGG - Exonic
927888171 2:26731075-26731097 CCGGGGGCTGCCCGGGGTGGGGG - Exonic
928511983 2:32010709-32010731 GAGGGCCCTGCCGGGGGTGGGGG - Intronic
929460299 2:42098440-42098462 CAGGAGCCTGGTGGGGGTGGGGG - Intergenic
929761980 2:44814512-44814534 CAGAGCCATGCAGGGGGTGGGGG + Intergenic
929814689 2:45221532-45221554 CTGGGGGCTGCAGGGGGTGGGGG - Intergenic
930861792 2:56081927-56081949 CCGGGGCCTGTTGGGGGTGGGGG + Intergenic
931242549 2:60466346-60466368 CTGGGGCCTGCATGGGGCTGTGG - Intronic
931479090 2:62621866-62621888 CAGGGACCTGCTTGAGGTGGCGG + Intergenic
931643895 2:64404473-64404495 CAGGGGCCGGCACAGGCTGCAGG + Intergenic
932024503 2:68119800-68119822 CAGGAGCCTGAAAGGGGAGGAGG - Intergenic
933360122 2:81271144-81271166 CAGGGGCCTGTCAGGGGTGGGGG + Intergenic
934539048 2:95159593-95159615 CGGGGGCTGGCGCGGGGTGGCGG - Exonic
934539059 2:95159617-95159639 CGGGGGCTGGCGCGGGGTGGCGG - Intronic
934539070 2:95159641-95159663 CGGGGGCTGGCGCGGGGTGGCGG - Intronic
934539081 2:95159665-95159687 CGGGGGCTGGCGCGGGGTGGCGG - Intronic
934655719 2:96116113-96116135 CTGTGGCCTGCACGGAGTAGGGG + Exonic
934709063 2:96503454-96503476 CAGGGGGCTGCCCGAGGTAGGGG - Intronic
934717209 2:96550982-96551004 CAGAGGACTGCAGGGGCTGGCGG + Intronic
935021417 2:99236127-99236149 CCGGGGCCTGTAGGGGGTGGGGG + Intronic
935215066 2:100969357-100969379 CCGGGGCCTGACAGGGGTGGTGG - Intronic
935273344 2:101454051-101454073 CCGGGGCCTGTCGGGGGTGGGGG - Intronic
935737191 2:106115613-106115635 GAGGGACCTGCAAAGGGTGGAGG + Intronic
936526042 2:113242215-113242237 CTGGGGACTGCAGGGGCTGGGGG + Intronic
936567508 2:113592409-113592431 CTGGGGCCTGAGCTGGGTGGTGG - Intergenic
936878901 2:117225889-117225911 CCGGGGCCTGTGTGGGGTGGGGG - Intergenic
937206251 2:120238884-120238906 CAGTGGCCTGCAAGGGTGGGTGG + Intergenic
937292272 2:120788821-120788843 CAGGGGCCTGCAAGTTGAGGGGG - Intronic
937293956 2:120798701-120798723 GAGGGGCCAGCTGGGGGTGGAGG + Intronic
937354106 2:121187373-121187395 CAGAGGCCTGAATGGGGTGCGGG + Intergenic
937819553 2:126293993-126294015 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
938108829 2:128550996-128551018 CTGGGTCCTGCAGGGTGTGGGGG + Intergenic
938301350 2:130216088-130216110 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
939022366 2:136974353-136974375 CTGGGGCCTGTGCGGGGCGGGGG - Intronic
939189325 2:138897514-138897536 CCAGGGCCTGCTCGAGGTGGTGG - Intergenic
939474958 2:142674991-142675013 CCGGGGCCTGTCGGGGGTGGGGG + Intergenic
939540265 2:143485244-143485266 CAGGGCCTTTCAAGGGGTGGGGG - Intronic
939607512 2:144270641-144270663 CTGGGGCCTGCCGGGGGTGGGGG + Intronic
940551211 2:155159000-155159022 CTGGGGCCTACTGGGGGTGGGGG + Intergenic
941770872 2:169344273-169344295 CTGGGGCCTGCTGGGGGTTGGGG - Intronic
941846011 2:170133893-170133915 CTGGGGCCTGTGGGGGGTGGTGG + Intergenic
941971580 2:171356564-171356586 CAGGGGCCAGGAAGGGGTGGGGG - Intronic
942010249 2:171755093-171755115 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
942804662 2:179915986-179916008 CTGGGGCCTGTAGGGGGTGGGGG + Intergenic
943060420 2:183037717-183037739 CTGGGCCTCGCACGGGGTGGGGG - Intronic
943111802 2:183616164-183616186 CTGGGGCCTGTCCGGGGTTGTGG - Intergenic
944625666 2:201566359-201566381 CTGGGGCCTGTGAGGGGTGGGGG - Intronic
944724763 2:202459493-202459515 CTGGGGCCAGCAAAGGGTGGAGG - Intronic
945333835 2:208568966-208568988 CAAGGGCCTGCCTGGCGTGGTGG + Intronic
945776261 2:214110291-214110313 CTGGGGCCTGTCAGGGGTGGGGG - Intronic
946020273 2:216635740-216635762 CTGGAGCCTGAAGGGGGTGGGGG + Intronic
946235573 2:218322919-218322941 CAGTGCCCTGGACGGGGAGGCGG + Intronic
946375854 2:219308683-219308705 CGGGGGACAGCACGGGGAGGGGG - Intronic
946476277 2:220009635-220009657 CTGGGGCCTCTATGGGGTGGGGG - Intergenic
947058779 2:226137941-226137963 CAGGAGCCTGCACAGATTGGAGG + Intergenic
947260773 2:228219598-228219620 CTGGGGCCTGTACGGGGGTGGGG + Intergenic
947463815 2:230324405-230324427 CAGGGGCCTGCATGGCATGAGGG - Intergenic
947472637 2:230412855-230412877 CAGGGGCCTGCATAGCGTGGGGG - Intergenic
947742500 2:232491037-232491059 CAGAGGTCTGGACAGGGTGGAGG - Intergenic
947772494 2:232681832-232681854 CGGGAGCTGGCACGGGGTGGTGG - Exonic
947873106 2:233450555-233450577 CAGCAGCCTGCACAGGCTGGGGG - Intronic
948205201 2:236159778-236159800 CAGGGCCGGGCCCGGGGTGGGGG - Intergenic
948208366 2:236174783-236174805 CAAGAGCCTGAAGGGGGTGGGGG - Intergenic
948301330 2:236909456-236909478 CGGGGACCTGCATGGGGTGCTGG + Intergenic
948514350 2:238494361-238494383 CTGTGGCCTGCACGGGCTGCCGG - Intergenic
948656414 2:239479424-239479446 TTGGAGCCTGCACGGGGTGGGGG + Intergenic
948695091 2:239729324-239729346 CTGGGGCCTGCTGTGGGTGGGGG + Intergenic
948846036 2:240683235-240683257 CAGGGACCTGGAGGGGGTGCAGG - Intergenic
948847820 2:240691494-240691516 CAGGGACCTGGAGGGGGTGCAGG + Intergenic
1168735121 20:128224-128246 CTGGGGCCTGCCAGGGGTGGGGG + Intergenic
1168799185 20:633613-633635 CAGGGGCCTGCTGGGGTGGGGGG + Intergenic
1171975807 20:31593943-31593965 CTGGGCCCTGCCCAGGGTGGAGG - Intergenic
1172455730 20:35071434-35071456 CAGGGCCTGGCATGGGGTGGGGG - Intronic
1174035133 20:47664074-47664096 CAGAGGCCTGCATGAGGAGGTGG - Intronic
1174670201 20:52299968-52299990 CAGGGGCTGTCAGGGGGTGGGGG + Intergenic
1175383009 20:58576634-58576656 CAGGGGGCTGCAGGGGAAGGGGG + Intergenic
1175687306 20:61040936-61040958 GAGGGGGCTGCACGGAGTTGGGG - Intergenic
1175806433 20:61831707-61831729 CAGGCTCCTGGGCGGGGTGGGGG + Intronic
1175922799 20:62457990-62458012 CAGCGGCATGCCCGAGGTGGGGG + Intergenic
1176015251 20:62927515-62927537 CAGGGACCTGGGGGGGGTGGAGG + Intronic
1176032967 20:63022630-63022652 CATGCGGCTGCAGGGGGTGGGGG + Intergenic
1176053832 20:63134531-63134553 GAGGGGCCTGGATGGGGAGGCGG + Intergenic
1176054082 20:63135096-63135118 GAGGGGCCTGGATGGGGAGGCGG + Intergenic
1177186327 21:17801682-17801704 CTGGGGCCTGTTGGGGGTGGGGG + Intronic
1177388672 21:20439187-20439209 CTGGGGCCTGCTGGGGGTGGCGG + Intergenic
1177722296 21:24923876-24923898 CTGGGGCCTGTCAGGGGTGGAGG - Intergenic
1177728382 21:24996411-24996433 CCGGGGCCTGTCAGGGGTGGGGG - Intergenic
1178839849 21:36130010-36130032 GAGGGCCCTGCCAGGGGTGGGGG + Intergenic
1178880268 21:36444283-36444305 CCGGGGCCTGTCGGGGGTGGAGG - Intergenic
1180095743 21:45554612-45554634 CAGGTCCCTGCACGGGGCAGCGG + Intergenic
1180155794 21:45976993-45977015 CAGGGTCCTGATGGGGGTGGGGG + Intergenic
1180166526 21:46033587-46033609 CAGGAGGCAGCACGGGGTGCGGG + Intergenic
1180166545 21:46033640-46033662 CAGGAGGCAGCACGGGGTGTGGG + Intergenic
1180612262 22:17105703-17105725 CCGAGGCCAGCCCGGGGTGGGGG + Intronic
1180964047 22:19776461-19776483 CAGGGGCCTGCACGGGGTGGAGG + Intronic
1181011111 22:20041066-20041088 CAGGGGCAGGCACTGAGTGGGGG + Intronic
1181029145 22:20141601-20141623 GTGGGGCCTTCACGGGGTGAAGG - Intronic
1181051165 22:20238901-20238923 CAGCAGCCCGCATGGGGTGGGGG + Intergenic
1181573199 22:23778951-23778973 CAGGGCCCTCCACGATGTGGGGG + Intronic
1181682095 22:24502455-24502477 CAGGGGCTTGGACCAGGTGGTGG - Intronic
1182413296 22:30204974-30204996 CTGGAGCCGGCCCGGGGTGGCGG + Intergenic
1182768474 22:32775917-32775939 CAGGGGGCTGTAGGGGGTAGAGG + Intronic
1182895900 22:33859028-33859050 CTGGGGCCTGTAGGGGGTCGGGG + Intronic
1183057226 22:35314433-35314455 CAGACTCATGCACGGGGTGGGGG + Intronic
1183091805 22:35527255-35527277 CAGGGGCCTCCACTGTGAGGGGG + Intergenic
1183544846 22:38449936-38449958 CACGGGCGCTCACGGGGTGGTGG - Intronic
1183603563 22:38854462-38854484 CAGGGCCCGTCAAGGGGTGGAGG - Intergenic
1183987044 22:41575630-41575652 CAGGGGTTTGCAGAGGGTGGGGG + Exonic
1184272664 22:43393481-43393503 GAGGGGGCTGGACTGGGTGGCGG + Intergenic
1184390339 22:44200089-44200111 CAGGGGCCTGGCGGGGGCGGAGG - Intronic
1184607773 22:45584024-45584046 CAGGGGCCCCCAGGAGGTGGTGG + Intronic
1184717118 22:46288596-46288618 GAGGGGCCTTCTCGGGGTGGGGG + Intronic
1184851739 22:47124999-47125021 CAGGGGCTTGCAGAGGGTGGCGG + Intronic
1185064305 22:48623086-48623108 CTGTGGGCTGCAGGGGGTGGCGG + Intronic
1185298045 22:50063873-50063895 GAGTGGCCTGCAGGGGGAGGGGG - Intronic
1185298098 22:50064009-50064031 GAGTGGCCTGCAGGGGGAGGGGG - Intronic
950530387 3:13549436-13549458 CAGAGGCCGGCGCGGGGTGGGGG + Intronic
950815742 3:15700284-15700306 CCGGGGCCTGTCCGGGGTGGGGG + Intronic
950900571 3:16493656-16493678 CAGGGGCCTGCAGGGGATGGGGG - Intronic
951109593 3:18786199-18786221 CAAGGGAGTGCAGGGGGTGGAGG - Intergenic
951368127 3:21810362-21810384 CTGGGGCCTGTCGGGGGTGGGGG + Intronic
951544480 3:23810792-23810814 CGGGGGCGCGCGCGGGGTGGGGG + Intronic
951911406 3:27754240-27754262 AGGGGGCCTGTAGGGGGTGGGGG - Intergenic
952842045 3:37654846-37654868 CCGGGGCCTGTCAGGGGTGGGGG - Intronic
953196686 3:40740917-40740939 CAGGAGTCTGCCTGGGGTGGGGG - Intergenic
953537994 3:43790384-43790406 CAGGGGCATGCACAGAGAGGTGG - Intergenic
953573685 3:44095519-44095541 CCGGGGCCTGTAGGGGTTGGGGG - Intergenic
953768023 3:45759041-45759063 CAGGGGGATGCACATGGTGGAGG + Exonic
953828541 3:46275894-46275916 CTGGGGCCTGTCCGGGGTGGAGG + Intergenic
954237434 3:49267573-49267595 GAGGGCCCAGCACAGGGTGGGGG - Intergenic
954486321 3:50855840-50855862 CTGGGGCCTGTCAGGGGTGGGGG - Intronic
955657304 3:61258489-61258511 CAGGGGCCTGTCAGGGGTTGGGG - Intergenic
957189945 3:76995103-76995125 CTGGGGCCTGTTGGGGGTGGGGG - Intronic
957650617 3:82997916-82997938 CTGGGGCCTGTAGGGGGTTGGGG + Intergenic
957959061 3:87226788-87226810 CAGGGGTCTGCGCGGTGCGGGGG + Intergenic
958562898 3:95770545-95770567 CAGGGGCCTGTCGGGGGTTGGGG + Intergenic
960565176 3:119125367-119125389 AAGGGGTCTGCAAAGGGTGGTGG + Intronic
960974710 3:123162833-123162855 CAGGGGCATGAATGGAGTGGGGG + Intronic
961531587 3:127543591-127543613 TAGAGGCCTGCACGGAGTGCCGG - Intergenic
961550818 3:127669751-127669773 CAGCAGACTGCACTGGGTGGGGG - Intronic
961772298 3:129258823-129258845 CAGGGCCCTGCTCTGGGTGTGGG + Intronic
962694562 3:137935166-137935188 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
963127512 3:141828939-141828961 CAGAGGGCTGCCTGGGGTGGTGG + Intergenic
963746946 3:149134138-149134160 CAGGGGCCTGCACTGGGCCACGG + Intronic
964236106 3:154530433-154530455 CTGGGGCCTGCATGGGGTGAGGG - Intergenic
964245708 3:154650205-154650227 CTGGGGCCTGCCGGGGGTTGGGG + Intergenic
965271630 3:166623411-166623433 CCAGGGCCTGCTGGGGGTGGGGG + Intergenic
965396417 3:168164866-168164888 AAGGGACCTACAGGGGGTGGTGG + Intergenic
965527473 3:169736324-169736346 CCGGGGCCTGAGTGGGGTGGGGG + Intergenic
966453475 3:180089163-180089185 CTGGGGCCTGTCAGGGGTGGGGG + Intergenic
966477079 3:180361540-180361562 GTGGGGCCTGCCGGGGGTGGGGG - Intergenic
966878386 3:184336230-184336252 GAGGAGCCTGCACCGGGAGGCGG + Intronic
966887913 3:184386892-184386914 CGGGAGCCTGCACCGGGTGTGGG - Exonic
966897498 3:184456733-184456755 CAGGTCCCTGCACGGAGTGGGGG - Intronic
967701612 3:192599098-192599120 CCGGAGCCTGTAGGGGGTGGGGG + Intronic
967938753 3:194749957-194749979 CAGGGTCCTGCAGGGAGTCGAGG - Intergenic
968514264 4:1009803-1009825 CAGGGGCGGGGACGGGGAGGGGG - Intergenic
968894123 4:3388740-3388762 CAGGAGCCTGGGCGGGGTCGGGG + Intronic
968899840 4:3425969-3425991 GTGGGGCCTGCACAGGGTAGGGG + Intronic
969047281 4:4345635-4345657 CCGGGGCCTGTTGGGGGTGGGGG - Intergenic
969217250 4:5732215-5732237 CAGGGCTCCGCACGTGGTGGGGG + Intronic
969542775 4:7803943-7803965 CAGGGGGCTGGATGGGGTAGGGG - Intronic
970109642 4:12623367-12623389 CTGGGGCCTGTCAGGGGTGGGGG + Intergenic
970250707 4:14112759-14112781 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
972253323 4:37328398-37328420 CTGGGGCCTGCTGGGGGTGGGGG - Intronic
972311956 4:37890707-37890729 CAGGGGTCTGGATGGGGCGGCGG + Intergenic
972574383 4:40338557-40338579 CAGGGGGCTCCCCTGGGTGGAGG + Intronic
972733680 4:41819325-41819347 CAGAGGCTAGCAGGGGGTGGTGG + Intergenic
972948303 4:44285459-44285481 CTGGGGCCTGTAGGGGGTCGGGG + Intronic
973290828 4:48468679-48468701 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
975247613 4:72138415-72138437 CTGGGGCCTGCATTGGGTGGGGG - Intronic
975431193 4:74293198-74293220 CTGGGGCCTGTCGGGGGTGGAGG - Intronic
975476609 4:74830777-74830799 CTGGGGCCTGTCGGGGGTGGGGG + Intergenic
976142965 4:82012090-82012112 CTGGGGCCTGTTGGGGGTGGAGG + Intronic
976991789 4:91376903-91376925 CTGGGGCCTGTCCTGGGTGGGGG - Intronic
977167171 4:93714093-93714115 CTGGGGCCTGTTGGGGGTGGGGG - Intronic
977859390 4:101938076-101938098 CTGGGGCCTGTCAGGGGTGGGGG + Intronic
978155663 4:105486899-105486921 CTGGGGCCTGTCGGGGGTGGGGG + Intergenic
978189696 4:105896623-105896645 CAGGGACCTACACGGAGGGGTGG - Intronic
978214326 4:106180537-106180559 TTGGGGCCTGTGCGGGGTGGGGG - Intronic
978249104 4:106609941-106609963 CAGTGGGCTACAGGGGGTGGGGG - Intergenic
978546866 4:109879688-109879710 TAATGGCCTGCACGGGGTGCTGG - Intergenic
978749531 4:112231707-112231729 CAGGGGCCTGGGCGCGCTGGGGG + Intergenic
979086171 4:116411945-116411967 CTGGGGCCTGCTGGGGGTTGGGG + Intergenic
979302229 4:119100201-119100223 CAGGGGCCTGTCGGGGGAGGGGG - Intergenic
979876530 4:125898470-125898492 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
980808955 4:137851102-137851124 CAGGGGCCTGTTGGGGGTGAGGG - Intergenic
982070294 4:151688279-151688301 CAGAAGCATGCACGGGGTGCTGG - Intronic
982668235 4:158291837-158291859 CAGGGGCCAGGCAGGGGTGGAGG + Intergenic
983134084 4:164058109-164058131 CTGGGGCCTGCAAGGAGTTGGGG + Intronic
983995409 4:174175946-174175968 CCGGGCCCTGCATGGGGTTGAGG - Intergenic
983998946 4:174217625-174217647 AAGGGGCCTGGACGCGGCGGTGG - Intergenic
985040235 4:185884065-185884087 AAGGGAACTTCACGGGGTGGAGG + Intronic
985539800 5:482649-482671 CGGGGGCCTGCGCGGGGCCGTGG - Exonic
985574183 5:665925-665947 GCGGGGCCTGGAGGGGGTGGGGG - Intronic
985728297 5:1526954-1526976 CTGGGGACTGCGAGGGGTGGGGG + Intergenic
985836071 5:2272842-2272864 CAGCTGCCTGCAGGGAGTGGTGG + Intergenic
985865126 5:2508708-2508730 CCGGGGGCAGCAGGGGGTGGGGG - Intergenic
985881482 5:2641877-2641899 CAAGGGGAGGCACGGGGTGGTGG - Intergenic
985904549 5:2823210-2823232 CAGGGGCCTGCTGGGGGCAGGGG + Intergenic
986252427 5:6072517-6072539 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
986366240 5:7035093-7035115 CAGGGGCCTGTCAGGGATGGGGG - Intergenic
986784140 5:11096318-11096340 CCGGGGCCTGGCAGGGGTGGGGG - Intronic
987279184 5:16395152-16395174 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
987391069 5:17375892-17375914 CTGGGGCCTGTCAGGGGTGGGGG - Intergenic
988627463 5:32893007-32893029 CAGGGGCCTGACAGGGGTCGGGG - Intergenic
988642765 5:33059633-33059655 CTGGGGCCTGTCGGGGGTGGGGG + Intergenic
988929884 5:36027653-36027675 CAGGGCCTTTCATGGGGTGGGGG - Intergenic
989138768 5:38181659-38181681 CCGGGGCCTGTTGGGGGTGGGGG + Intergenic
989269106 5:39510994-39511016 CCGGGGCCTGACGGGGGTGGAGG + Intergenic
990062813 5:51673006-51673028 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
990396389 5:55384629-55384651 CAGTGGCCTGCAAGAGGTGGAGG - Intronic
990572013 5:57088321-57088343 CAGGGGCCTGTTGGGGGTGAGGG + Intergenic
990874240 5:60466889-60466911 CAAGGGCCTATACTGGGTGGGGG - Intronic
991635174 5:68697488-68697510 CTGGGGCCTGCCAGGGGTGGGGG + Intergenic
991914745 5:71594588-71594610 CAGGTGCCTGCTGGGGATGGTGG + Intronic
993048778 5:82899928-82899950 CTAGGGCCTGCGGGGGGTGGCGG + Intergenic
993749792 5:91652016-91652038 AAAGGGCCTGCATGGGGGGGAGG - Intergenic
994113742 5:96038525-96038547 CCAGGGCCTGCGGGGGGTGGGGG - Intergenic
994687544 5:102974394-102974416 CAGGTGCCTTCACCAGGTGGGGG - Exonic
995976271 5:118039124-118039146 CCGGGGCCTGTCGGGGGTGGGGG + Intergenic
995997006 5:118312571-118312593 CTGGGGCCTGTCAGGGGTGGGGG - Intergenic
996146651 5:119985308-119985330 CCGGGGCCTGCAGGGGGTAGGGG - Intergenic
996986888 5:129578597-129578619 CCAGGGCCTTCAAGGGGTGGGGG - Intronic
997001010 5:129762001-129762023 CTGGGGCCTGTGAGGGGTGGGGG + Intronic
997112986 5:131095584-131095606 CCGGGGCCTGTCAGGGGTGGGGG - Intergenic
997378872 5:133421108-133421130 CAGGCCCCTGCCAGGGGTGGAGG - Intronic
997582085 5:135024477-135024499 CAGGGACCAGCAGGGGCTGGGGG + Intergenic
999248140 5:150166577-150166599 CCAGGGCCTGGAGGGGGTGGGGG - Intergenic
1000809206 5:165839679-165839701 CTGGGGCCTGTCCAGGGTGGGGG - Intergenic
1001779102 5:174352214-174352236 CCGGGGCCTGTCAGGGGTGGGGG + Intergenic
1001891859 5:175345958-175345980 CCGGGGCCTGTCGGGGGTGGGGG + Intergenic
1002173952 5:177391063-177391085 GAGGGGCCTGAAGCGGGTGGTGG - Intronic
1002189122 5:177469768-177469790 CCTGGGCCTGCATGGGGTGATGG - Intronic
1002522975 5:179801518-179801540 CAGGGAGGAGCACGGGGTGGGGG - Intronic
1002686731 5:181017804-181017826 CAGGGCCTTTCAGGGGGTGGAGG + Intergenic
1002817516 6:693812-693834 CAGGGGGCTGCAGGGGTTTGAGG + Intergenic
1002849960 6:985201-985223 CGGGGGCCTGTAGGGGGTTGAGG - Intergenic
1003097915 6:3156879-3156901 CAGGTGACTGCGCTGGGTGGGGG - Intronic
1003101648 6:3180450-3180472 CAGGTGACAGCACTGGGTGGAGG - Intergenic
1003104018 6:3200227-3200249 CAGGGGCCAGCACGGATTGATGG - Intergenic
1003116878 6:3289222-3289244 CTGGGTCCTGCAGGGGCTGGGGG - Intronic
1003206980 6:4021517-4021539 GTGGGAGCTGCACGGGGTGGCGG + Intronic
1003643924 6:7899032-7899054 CAGAGGGCTGCAGGTGGTGGAGG + Intronic
1004799003 6:19124722-19124744 CCGGGGCCTGTTGGGGGTGGTGG + Intergenic
1005686418 6:28257376-28257398 CAAGGGCCTGTGGGGGGTGGAGG + Intergenic
1005753880 6:28908411-28908433 CAGGTGCCAGCTCGGGCTGGAGG - Intronic
1005806796 6:29481005-29481027 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
1006349373 6:33509630-33509652 CAGGGTCCAGGAAGGGGTGGGGG + Intergenic
1006458437 6:34144775-34144797 CAGGGGCTTCCACCGGATGGAGG - Intronic
1006460423 6:34154753-34154775 AAGGGGCCTGCCCGGGGCAGTGG - Intronic
1006517588 6:34553406-34553428 GTGGGGCATGAACGGGGTGGGGG + Intronic
1006983487 6:38163284-38163306 CAGGAGCCTGCAGGGGTTGAGGG - Intergenic
1006984386 6:38167335-38167357 CAGTGGCCTGGGCGGGGCGGTGG + Intergenic
1007193036 6:40036200-40036222 GAGGAGCCTGAATGGGGTGGAGG - Intergenic
1007784265 6:44270980-44271002 CAGCGGCCGGCTCGGGGTGCGGG - Intronic
1010583509 6:77628518-77628540 CTGGGGCCTGGGGGGGGTGGGGG - Intergenic
1011021348 6:82816596-82816618 CTGGGGCCTGTCAGGGGTGGGGG + Intergenic
1011303672 6:85903185-85903207 CCGGGGCCTGTTGGGGGTGGCGG - Intergenic
1012391915 6:98751227-98751249 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
1014158936 6:118144424-118144446 CTGGGGCCTGCAGGGGGTCGGGG + Intronic
1014237044 6:118969800-118969822 CAGGGCCTGTCACGGGGTGGGGG - Intronic
1015067747 6:129051870-129051892 CAGGGGCATGAACGGAGTTGTGG + Intronic
1015068028 6:129054483-129054505 CAGGGGCATGAACGGAGTTGTGG + Intronic
1015328357 6:131950439-131950461 CACGTGCCTGGACGGGGCGGTGG - Exonic
1015548486 6:134386838-134386860 CAGGGCCTGTCACGGGGTGGAGG + Intergenic
1016388229 6:143549335-143549357 CAGAGGCCTGCTCGGGGTGCGGG + Intronic
1016412341 6:143796564-143796586 CTGGGGCCTGTAGGGGGTGGGGG - Intronic
1016905416 6:149145809-149145831 CTGGGGCCTGTAGGGGGTGGGGG - Intergenic
1016985502 6:149891881-149891903 CAGGGCCTGTCACGGGGTGGGGG - Intronic
1017231622 6:152079171-152079193 CAGGGACCTGCTTGAGGTGGCGG - Intronic
1017369388 6:153687561-153687583 CCGGGGCCTGTAGGGGGTGGGGG - Intergenic
1018749223 6:166788673-166788695 CCGGGGCCTGTCCGGGGTGAGGG + Intronic
1018807075 6:167270034-167270056 CCAGAGGCTGCACGGGGTGGGGG + Intergenic
1018975730 6:168563903-168563925 CAGGGGCCTGCAGGGGGCGGGGG + Intronic
1019054504 6:169213595-169213617 TGTGGGACTGCACGGGGTGGGGG + Intergenic
1019073586 6:169369243-169369265 CGGCAGCCTGCACAGGGTGGTGG - Intergenic
1019198682 6:170296743-170296765 CAGGAGCCCGCGCGGGGTGGGGG + Intronic
1019316838 7:390847-390869 CTGGGGGCTGCAGGGGCTGGCGG + Intergenic
1019361984 7:609397-609419 CAGGGTCCTGAGCTGGGTGGTGG - Intronic
1019484046 7:1280259-1280281 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
1019497237 7:1346319-1346341 CAGAGGCCGGAACGGGCTGGAGG - Intergenic
1019520521 7:1458766-1458788 CAGGGGCCTGAACAGGCTGGGGG + Intronic
1019594447 7:1851957-1851979 CAGGGCCCGGCACGGGTGGGCGG + Intronic
1019918020 7:4145634-4145656 CAGGGGTCAGCACAGGGTGTGGG + Intronic
1020144830 7:5634463-5634485 CTGGGGACAGCAAGGGGTGGGGG - Intronic
1020584834 7:10053310-10053332 CTGGGGGCTGCTCGGGGTGGGGG + Intergenic
1020690395 7:11347870-11347892 CTGGGGCCTGTCAGGGGTGGGGG - Intergenic
1020759874 7:12255118-12255140 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
1022518370 7:30989635-30989657 CGGGGGCCCTCACAGGGTGGAGG + Intronic
1022688841 7:32625079-32625101 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
1022869687 7:34463169-34463191 CTGGGGCCTGTGGGGGGTGGGGG + Intergenic
1023021065 7:36012031-36012053 CTGGGGGCTGCCTGGGGTGGAGG + Intergenic
1023311273 7:38888944-38888966 CTGGGGCCTGTGGGGGGTGGGGG + Intronic
1023983073 7:45080836-45080858 CAGGGCCTCGCAGGGGGTGGTGG - Intronic
1024066106 7:45738041-45738063 CTGGGGCCTGTCAGGGGTGGAGG + Intergenic
1024613305 7:51085393-51085415 CAGGGACCTGCACCGGAAGGTGG + Intronic
1024698404 7:51880607-51880629 CCAGGGCCTGCAGTGGGTGGGGG - Intergenic
1026107357 7:67431794-67431816 CAGGGCCTTTCAGGGGGTGGGGG + Intergenic
1026923827 7:74174862-74174884 CAGGGGCCTGCAAGGCGGGCAGG - Intronic
1027864036 7:83623878-83623900 CTGGGGCCTGTTGGGGGTGGGGG - Intronic
1028366287 7:90036536-90036558 CTGGGGCCTGTCAGGGGTGGGGG + Intergenic
1028862353 7:95667097-95667119 CTGGGGCCTGTGAGGGGTGGGGG + Intergenic
1028888044 7:95956536-95956558 CTGGGGCCTGTCGGGGGTGGGGG - Intronic
1029117168 7:98243341-98243363 CAGGAGCAGGCATGGGGTGGGGG + Intronic
1029638721 7:101804343-101804365 CAGGGGACAGCAAGGGGTAGGGG + Intergenic
1030495572 7:110295407-110295429 CTGGGGCCTGCTGGGGGTGTAGG - Intergenic
1030843464 7:114382426-114382448 AAGGGGCATGGACGAGGTGGTGG + Intronic
1032098743 7:128955159-128955181 CTGTGGCCTGCCCGGCGTGGTGG - Exonic
1032308962 7:130764610-130764632 CTGGGGCCTGTCAGGGGTGGGGG - Intergenic
1032946159 7:136855324-136855346 CCGGGGCCTGTTGGGGGTGGGGG - Intergenic
1033083495 7:138320699-138320721 CTGGGGCCTGTCGGGGGTGGGGG + Intergenic
1033792108 7:144802981-144803003 CAGGGGCCTGTCAGGGGTGGTGG + Intronic
1034192090 7:149220783-149220805 CAGGGCCATGCATGGGTTGGGGG + Intronic
1034415252 7:150961171-150961193 CTGGGGCCAGCACTGGCTGGTGG + Intronic
1034546180 7:151790951-151790973 CAGGCGGCTGCCCGGAGTGGTGG + Intronic
1035053443 7:156017981-156018003 GAGGGGCCTGGAGAGGGTGGTGG + Intergenic
1035310451 7:157964559-157964581 TTGTGGCCTGCACGGGGTTGTGG - Intronic
1035622495 8:1044401-1044423 CAGGTGGCTGCACAGGCTGGAGG + Intergenic
1035634490 8:1134000-1134022 CAGGGGCCTGTGGGAGGTGGAGG - Intergenic
1035689853 8:1553080-1553102 CAGGAGCCTTCCCGGGGAGGCGG - Intronic
1036786264 8:11689724-11689746 CAGTGCCCTGCAAGGGGTGTGGG + Intronic
1036797698 8:11768328-11768350 CAGGGGCATCCTGGGGGTGGGGG + Intergenic
1036897657 8:12648882-12648904 CCGGGGCCTGTCGGGGGTGGGGG + Intergenic
1037067198 8:14596660-14596682 CAGGGTCTCTCACGGGGTGGGGG + Intronic
1037215856 8:16450009-16450031 CAGGGGCCTGTCGGGGTTGGGGG + Intronic
1037482070 8:19314102-19314124 TGGGGGCTTGCAGGGGGTGGCGG + Intronic
1037601658 8:20401359-20401381 CTGGGGCCTGCGGGGAGTGGGGG - Intergenic
1037764502 8:21763906-21763928 CAGGAGCCAGCATGGAGTGGGGG - Intronic
1037987282 8:23297912-23297934 TAGGGGTCTGGACAGGGTGGGGG + Exonic
1038652784 8:29420824-29420846 CAGGGGCCTGGAGGTGCTGGGGG + Intergenic
1038855001 8:31321321-31321343 CAGTGGCCTTCACTGGGTTGTGG + Intergenic
1039020331 8:33197770-33197792 CAGGGGCGGCCAAGGGGTGGGGG + Intergenic
1039024870 8:33247212-33247234 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
1040319677 8:46286292-46286314 CAGAGGCCTCCACCAGGTGGGGG - Intergenic
1042089505 8:65143628-65143650 CAGGGCCCAGCATGGGCTGGTGG - Intergenic
1042873982 8:73424056-73424078 CAGGGGGCTGGTGGGGGTGGGGG - Intronic
1042936340 8:74062399-74062421 CTGGGGCCTGTCCGGGGTTGGGG - Intergenic
1043352016 8:79372967-79372989 CAGGGCCTGTCACGGGGTGGGGG + Intergenic
1043382942 8:79722547-79722569 CAGTTGCCTGCAGGGGATGGGGG - Intergenic
1043977193 8:86597013-86597035 CTGGGGCCTGTCGGGGGTGGGGG + Intronic
1044759993 8:95507693-95507715 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
1045703864 8:104897641-104897663 CTGGGGCCTGTTGGGGGTGGGGG + Intronic
1046919722 8:119715432-119715454 CAGAGTCCTGGATGGGGTGGGGG + Intergenic
1046976069 8:120279137-120279159 CGGGGGCCTGTCGGGGGTGGGGG + Intronic
1047736901 8:127773734-127773756 CTGGGGCCTGTCGGGGGTGGGGG + Intergenic
1047917628 8:129599717-129599739 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
1048055641 8:130860794-130860816 CCGGGGCCTGTTGGGGGTGGGGG - Intronic
1048409160 8:134153972-134153994 CTGGGGCCTGCTGGGGGTTGGGG - Intergenic
1048878784 8:138856981-138857003 GAGGGGCAGGCACAGGGTGGGGG - Intronic
1048997893 8:139805343-139805365 GAGGGCCCTGCACCGGGAGGAGG - Intronic
1049168402 8:141141397-141141419 CAGGGGGCTGGAGGTGGTGGGGG + Intronic
1049270446 8:141692947-141692969 CAGGGGGGCGCACGGGGTGCAGG - Intergenic
1049442871 8:142617222-142617244 CAGGGACGGGCACGGGGTGGGGG - Intergenic
1049515226 8:143050908-143050930 CAGGGCCCGGCTCGGGGTCGGGG + Intronic
1049532087 8:143159916-143159938 CAGGTGCCGGCGCGGGGCGGAGG - Intronic
1049641063 8:143716259-143716281 CCGGGGCCTGCCGGGGGCGGGGG + Exonic
1049679781 8:143912994-143913016 CAGAGGGCTGCACGGGCAGGTGG + Intergenic
1049708892 8:144054953-144054975 CAGGGGCCAGAGCGGGGTGGGGG + Intronic
1049885026 9:21124-21146 CTGGGGCCTGAGCTGGGTGGTGG + Intergenic
1050972795 9:11897872-11897894 CTGGGGCCTGTCAGGGGTGGGGG + Intergenic
1052554928 9:30001260-30001282 CAGGGCCTTTCATGGGGTGGGGG - Intergenic
1052826975 9:33184005-33184027 CTGGGGCCTGCTGGGGGTTGGGG + Intergenic
1053475979 9:38382261-38382283 CAGGGGCCACCAGAGGGTGGGGG + Intergenic
1053656334 9:40221759-40221781 CAGGCGCCAGCATGGGCTGGCGG - Intergenic
1054266842 9:62925860-62925882 CCGGAGCCAGCAGGGGGTGGCGG + Intergenic
1054550335 9:66595314-66595336 CCGGAGCCAGCAGGGGGTGGCGG + Intergenic
1054971582 9:71094073-71094095 CTGGGGCCTGTCAGGGGTGGGGG + Intronic
1055348806 9:75363791-75363813 CTGGGGCTTGTAGGGGGTGGGGG - Intergenic
1055504678 9:76935870-76935892 CTGGGGCCTGTTTGGGGTGGGGG - Intergenic
1055694638 9:78870654-78870676 CAGGGGCTTCCAGGGGGTGGTGG + Intergenic
1056578002 9:87870618-87870640 CAGGTGCCTGCAAGGGCTGCAGG - Intergenic
1056723135 9:89088732-89088754 GAGGGGCCTGCACGGAGAGCAGG + Intronic
1056750894 9:89350343-89350365 CAGGGAGATGCACGGGGTAGTGG + Intronic
1057034942 9:91805187-91805209 CAGAGGCCTGCAGGTGGTGCTGG - Intronic
1057871519 9:98721769-98721791 CAGGGCCCTGCAGGAGGTGGAGG - Intergenic
1058063570 9:100524894-100524916 CCGGGGCCTGCCAGGGGTGGGGG - Intronic
1058075463 9:100646035-100646057 CTGGGGCCTGTGAGGGGTGGGGG - Intergenic
1059178515 9:112189880-112189902 CCGGGGCCTGTGGGGGGTGGGGG - Intergenic
1059460815 9:114428809-114428831 CAGGGGGCTGATGGGGGTGGAGG - Intronic
1060176389 9:121500012-121500034 CTCGGGCCTGCACGTGGTGGTGG + Intergenic
1060424249 9:123491700-123491722 CAGGGTCCTGGATGGGCTGGAGG - Intronic
1060567721 9:124608296-124608318 CTGGGGCCTGTTGGGGGTGGGGG - Intronic
1060588961 9:124803987-124804009 CAGGGGCCCTCAGGGAGTGGAGG - Intronic
1060974241 9:127755175-127755197 CCGGGGCCGGGACGGTGTGGGGG + Intronic
1060984876 9:127814134-127814156 CAGGGACCTGCACTGTGTAGAGG + Intronic
1061079509 9:128361595-128361617 CAGGGTCCTGCCCGAGGTGACGG - Intergenic
1061248389 9:129413293-129413315 GCGGGGCCCGGACGGGGTGGCGG + Intergenic
1061288297 9:129636714-129636736 CAAGGGCCTCCACAGTGTGGAGG - Intronic
1061489677 9:130938270-130938292 CAGGGGGCTGCTGGGGGTGCGGG + Intronic
1062010587 9:134264729-134264751 AACGGGCCTTCATGGGGTGGGGG - Intergenic
1062191262 9:135249073-135249095 CAAGGGCTGGCATGGGGTGGGGG - Intergenic
1062229613 9:135474428-135474450 CAGGAGCCTGCCCAGGGCGGGGG - Intergenic
1062294079 9:135814502-135814524 GAGGGTCCTGCACGGGGTCTAGG - Intronic
1062320941 9:135990295-135990317 CAGGAGCCTGCAGGGTGTGGGGG - Intergenic
1062354922 9:136157412-136157434 CCTGGGCCTGCTCGTGGTGGGGG + Intergenic
1062460561 9:136660981-136661003 CAGGGGCATGCAGGTGGGGGAGG + Intronic
1062595481 9:137297157-137297179 AAGGGGCCTGCCTGGGGAGGGGG + Intergenic
1203769180 EBV:40347-40369 CAGGGGCCCGGCGGGGGTGGGGG + Intergenic
1185457079 X:316598-316620 CTGGGGCCTGCAGGGGCAGGTGG + Intronic
1185467143 X:361840-361862 CAGGGCCCTGCTCGGTGTGATGG - Intronic
1185556065 X:1022201-1022223 CTGGGGCCCGCCAGGGGTGGAGG + Intergenic
1185668407 X:1786789-1786811 CAATCTCCTGCACGGGGTGGCGG + Intergenic
1185695452 X:2190886-2190908 CCGGGGCCTGCTGGGGGTTGGGG + Intergenic
1186618945 X:11216869-11216891 CTGGGGCCTGTCGGGGGTGGAGG - Intronic
1186631703 X:11356250-11356272 CCGGGGCCTGTTGGGGGTGGGGG + Intronic
1186974157 X:14882000-14882022 CAGGGCCTGGCATGGGGTGGGGG + Intronic
1187004290 X:15216740-15216762 CAGTGGCCTGCAGGGGTTTGTGG - Intergenic
1188034174 X:25297979-25298001 CAGGGGTGGGCATGGGGTGGAGG + Intergenic
1189942044 X:46134633-46134655 CCAGGGCCTGTAGGGGGTGGGGG + Intergenic
1190123696 X:47684842-47684864 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
1190511066 X:51174974-51174996 CCGGAGCCTGCCAGGGGTGGGGG + Intergenic
1190692358 X:52921890-52921912 CAGGCGCCAGGACGGCGTGGGGG - Intergenic
1190943404 X:55067209-55067231 CCGGGGCCTGTCAGGGGTGGGGG - Intergenic
1191677176 X:63803737-63803759 CCGGGGCCTGCTGGGGGTTGGGG + Intergenic
1192530868 X:71883444-71883466 CTGGGGCCTGTCGGGGGTGGGGG + Intergenic
1192637548 X:72833624-72833646 CTGGGGCCTGTTGGGGGTGGGGG + Intronic
1192644166 X:72887190-72887212 CTGGGGCCTGTTGGGGGTGGGGG - Intronic
1192784911 X:74326001-74326023 CAGGGGCCGGGGCGGGGCGGGGG - Intergenic
1192898205 X:75466880-75466902 CTGGGGCCTGTTAGGGGTGGGGG + Intronic
1193013017 X:76698399-76698421 CCGGGGCCTGTCGGGGGTGGGGG + Intergenic
1193030415 X:76892141-76892163 CAGGGGCCTGTCAGGGGTGGGGG + Intergenic
1193032336 X:76912297-76912319 CTGGGGCCTTCAGGGGGTAGAGG + Intergenic
1193222076 X:78937464-78937486 CAGGGCCTGTCACGGGGTGGGGG - Intergenic
1193615474 X:83683081-83683103 CTGGGGCCTGTCGGGGGTGGGGG - Intergenic
1193658705 X:84230043-84230065 CCGGGGCCTGTCGGGGGTGGGGG + Intergenic
1193830532 X:86283713-86283735 CTGGGGCCTGTTGGGGGTGGGGG + Intronic
1194190719 X:90834040-90834062 CCGGGGCCTGTCGGGGGTGGGGG - Intergenic
1195008206 X:100708062-100708084 CCGGGGCCTGTCGGGGGTGGGGG + Intronic
1195149665 X:102053313-102053335 CTGGGGCCTGTCGGGGGTGGGGG + Intergenic
1196243742 X:113373776-113373798 CTGGGGCCTGTCAGGGGTGGGGG + Intergenic
1196409246 X:115398777-115398799 CTGGGGCCTGTCAGGGGTGGTGG + Intergenic
1196459522 X:115915971-115915993 CAGGGCCTGTCACGGGGTGGGGG + Intergenic
1196536381 X:116850319-116850341 CCGGGGCCTGTTGGGGGTGGGGG - Intergenic
1196630937 X:117939093-117939115 CAGGGCCTTTCAGGGGGTGGGGG - Intronic
1197086298 X:122480096-122480118 CTGGGGCCTGTTGGGGGTGGGGG - Intergenic
1197142672 X:123133537-123133559 CAGGGCCTGTCACGGGGTGGGGG + Intergenic
1197169415 X:123414575-123414597 CTGGGGCCTGTCGGGGGTGGGGG - Intronic
1197506540 X:127311720-127311742 CTGGGGCCTGCTGGGGGTTGGGG + Intergenic
1197628487 X:128830990-128831012 CTGGGGCCTGCCGGGGGTGGGGG - Intergenic
1197814115 X:130478900-130478922 CTGGGGCCTGCTGGGGGTTGGGG + Intergenic
1198846479 X:140917858-140917880 CAGAGGCCTGAATGGGGTGAGGG + Intergenic
1199080067 X:143567167-143567189 CTGGGGCCTGTTGGGGGTGGGGG + Intergenic
1199402370 X:147413318-147413340 CTGGGGCCTGTCAGGGGTGGAGG + Intergenic
1199836119 X:151593398-151593420 CTGGGGCCTGTCAGGGGTGGGGG - Intronic
1200072010 X:153533849-153533871 CAGGGGCAGGGACCGGGTGGGGG + Intronic
1200268077 X:154656950-154656972 CCGGGGCCTGTTGGGGGTGGGGG + Intergenic
1200599747 Y:5191144-5191166 CCGGGGCCTGTCGGGGGTGGGGG + Intronic
1200692985 Y:6326966-6326988 CCAGGGCCTGCCAGGGGTGGAGG + Intergenic
1201042287 Y:9847760-9847782 CCAGGGCCTGCCAGGGGTGGAGG - Intergenic