ID: 1180971059

View in Genome Browser
Species Human (GRCh38)
Location 22:19815974-19815996
Sequence CTGTGTGCACAGGGCTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180971059_1180971070 30 Left 1180971059 22:19815974-19815996 CCCTCCTAGCCCTGTGCACACAG 0: 1
1: 0
2: 1
3: 24
4: 298
Right 1180971070 22:19816027-19816049 CAACACCGCATCCTGACCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1180971059_1180971069 29 Left 1180971059 22:19815974-19815996 CCCTCCTAGCCCTGTGCACACAG 0: 1
1: 0
2: 1
3: 24
4: 298
Right 1180971069 22:19816026-19816048 TCAACACCGCATCCTGACCAAGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180971059 Original CRISPR CTGTGTGCACAGGGCTAGGA GGG (reversed) Intronic
900168320 1:1253846-1253868 CTCTGTGCTCAGGGCTGGGGTGG - Intergenic
900245766 1:1635330-1635352 CTGTGTGGACAGGGCTGGTCTGG + Intronic
900256996 1:1702487-1702509 CTGTGTGGACAGGGCTGGTCTGG + Intronic
900380609 1:2382085-2382107 CTCTGGGGACAGGGCTAGGCTGG + Intronic
902050467 1:13560372-13560394 CTCTGTGCACAGACCAAGGAAGG + Intergenic
902177524 1:14662099-14662121 CTGTGTGCCCTGGGTCAGGAAGG + Intronic
902532875 1:17101680-17101702 CTGAGAGCACAGGGCTAGAGAGG + Intronic
903130037 1:21273006-21273028 CTGTGTGGTCAGGGCCAGGGTGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
904314622 1:29652184-29652206 CTGTGAGCGCAGGGCCAGGGAGG + Intergenic
904571732 1:31471117-31471139 CTCTGTGCACAGACCGAGGAAGG - Intergenic
906381480 1:45334751-45334773 CTGTGAGGCCAGGGCTGGGATGG + Intronic
907513228 1:54977919-54977941 CAGTGTGCTCAGGCCTAGGATGG + Intergenic
907650011 1:56286124-56286146 TGGTGTACACAGGGGTAGGATGG - Intergenic
907828547 1:58041755-58041777 CTGTGTGCTCTAGGCTATGAAGG + Intronic
909787098 1:79627620-79627642 CTGTGTGAATAGAACTAGGATGG - Intergenic
910601542 1:89037990-89038012 CTGTGTGCACAGCCCTGGGCTGG + Intergenic
910669870 1:89762334-89762356 GTGTGTGGGCAGGGCTAGGAAGG - Intronic
912451796 1:109771990-109772012 GTGTGTGCACAGAGCCAGCATGG + Intronic
913483499 1:119312302-119312324 CTGTGTAGAAAGGGGTAGGATGG + Intergenic
915314253 1:155018969-155018991 CTGAGGCCACATGGCTAGGAAGG + Intronic
915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG + Intronic
916206330 1:162319411-162319433 TTGTGGGCTCAGGGCAAGGATGG - Intronic
916552247 1:165860105-165860127 CTGCGTGCACAGGGTTAAGGTGG - Intronic
917586789 1:176435022-176435044 TTGTGTGCACAAGGCTATTAAGG - Intergenic
917642748 1:176998656-176998678 CTGTGTGCACAGCGGTCGGGTGG - Intronic
918185859 1:182127231-182127253 CTGGAGGAACAGGGCTAGGAAGG + Intergenic
918246161 1:182661315-182661337 CTGTTTGCACAGGGCATGGAGGG - Intronic
919843009 1:201623015-201623037 CTGTGGGCTCAGGGCCAGGCCGG - Intronic
919845711 1:201640870-201640892 CTGTGTGCACAGAGCTGGGATGG + Intronic
920224968 1:204431821-204431843 CTGGGTGCAGAGGGCTCGGCAGG - Intronic
921290122 1:213649430-213649452 CTGTGGCCAGAGGGCTAGGTGGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063539474 10:6917861-6917883 GAATGTGCAAAGGGCTAGGAAGG + Intergenic
1063611036 10:7562143-7562165 ACATGTGCACAGTGCTAGGACGG - Exonic
1065324175 10:24536063-24536085 CTGTGTCTACAGGGCTAAAAAGG - Intronic
1065810504 10:29438618-29438640 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1066424183 10:35290917-35290939 TTGTGTGCCCAGGGCTGGAAAGG - Intronic
1069115907 10:64506344-64506366 CTATGTGGGCATGGCTAGGATGG + Intergenic
1069631847 10:69902027-69902049 GTGTGTGAGAAGGGCTAGGAGGG + Intronic
1069823311 10:71240478-71240500 CCGTGGGCACAGGGCCAGCAGGG + Intronic
1070305804 10:75238512-75238534 CTGTATGCTCAGGCCTGGGAAGG - Intergenic
1070747630 10:78944261-78944283 TTGTGTGCAGAGGGCAGGGATGG + Intergenic
1071283805 10:84125952-84125974 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1071495126 10:86162826-86162848 CCCTGTGCACAGGGCTGAGATGG + Intronic
1075060311 10:119252469-119252491 CTGGGTGCAGAGGGCTACGCTGG + Intronic
1075179346 10:120196118-120196140 GTGTGTGCACAGGGTGATGATGG + Intergenic
1075321263 10:121493382-121493404 CTGGGTCCTCAGGGCTAGGGTGG + Intronic
1075713399 10:124542649-124542671 CAGGGTGCACAGGGCTGGGATGG - Intronic
1076851642 10:133096174-133096196 ATGCGTGCACAGGCCCAGGAGGG - Intronic
1081872582 11:46390282-46390304 CTCTGGGCACCGGGCTAAGACGG - Intergenic
1083174149 11:60938902-60938924 CTGCGGGCCCAGGGCTAGGCTGG - Intronic
1083620893 11:64048878-64048900 CTGTGGGGACAGGGCAAGGGCGG - Intronic
1083955623 11:65981459-65981481 CCATGTGCCCAGGGCTGGGAGGG + Intergenic
1084013823 11:66367343-66367365 CTGTTTGCACAAGGCTACTAGGG + Intronic
1084115742 11:67042002-67042024 CTGTGAGCAGAGTGCGAGGAGGG + Intronic
1085271790 11:75274040-75274062 CTAGGAGCCCAGGGCTAGGAGGG + Intronic
1085791949 11:79504029-79504051 CTAAGGGCACATGGCTAGGAAGG + Intergenic
1089677498 11:120099591-120099613 CGTTGTGAACAGGGATAGGACGG - Intergenic
1090251648 11:125255872-125255894 CTGTGGGCAAGGGGCTGGGAAGG - Intronic
1091207655 11:133832711-133832733 CCGTGCCCACAGGGCTGGGAGGG + Intergenic
1091529800 12:1343188-1343210 CTGTTTGCACAGGGCTCTGCTGG - Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1093862723 12:24187053-24187075 CTGATTTCACAGGGCCAGGAGGG + Intergenic
1094187524 12:27661094-27661116 CTGTATGCACAGGAATAGGGAGG + Intronic
1094328579 12:29268246-29268268 CTATGTGGACAGGGTTTGGATGG - Intronic
1094802762 12:34056259-34056281 CAATGTACACAGGACTAGGAGGG - Intergenic
1095116172 12:38354751-38354773 CAATGTACACAGGACTAGGAGGG - Intergenic
1095989716 12:48026359-48026381 CAGTGTACTCAGGGCCAGGACGG + Intergenic
1097140192 12:56896075-56896097 ATGTGTGCACAAGGTAAGGATGG - Intergenic
1097460741 12:59858721-59858743 CTGTTTGGACAGGGCAAGGTTGG + Intergenic
1097893320 12:64800145-64800167 CCCTGTGGACAGGGGTAGGAGGG + Intronic
1100023914 12:90104483-90104505 CAGTGTGCACAAAGCTGGGAAGG + Intergenic
1100514553 12:95314492-95314514 CTGTAAGAACAGGGCTAGGAAGG + Intergenic
1102432845 12:112897119-112897141 GTGTGTGTTCAAGGCTAGGAGGG - Exonic
1103070097 12:117934227-117934249 CTTGGTCCACAGGGCTTGGAAGG + Intronic
1103128780 12:118448436-118448458 CTCAGTGCCCAGGGCTAGCAGGG + Intergenic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1105898868 13:24740373-24740395 ATGTGTGCAGAGTGCTACGAGGG + Intergenic
1106275968 13:28206913-28206935 ATGAGTGCAGAGGACTAGGAGGG - Intronic
1113512261 13:110865606-110865628 CTCTTAGCACAGGTCTAGGAGGG - Intergenic
1113676597 13:112211536-112211558 CTGTGTAGACAGTGCTGGGAAGG - Intergenic
1115537177 14:34384419-34384441 CTGTGAGCCTAGGGCTGGGATGG - Intronic
1117179897 14:53181153-53181175 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1117997327 14:61490026-61490048 CTGTGTGCCCAGGGGTAACATGG - Intronic
1118121945 14:62855479-62855501 CAATTTGCACAGGGCTATGAGGG - Intronic
1118817182 14:69321869-69321891 CTGTGTGCTCAAAGCTAGGCTGG + Intronic
1119199827 14:72744106-72744128 CTGTCTGCATGGGGATAGGAAGG - Intronic
1121327256 14:93028439-93028461 CTGTGTGCCCACGCCAAGGATGG + Intronic
1122006220 14:98705991-98706013 CTGTGTGTGCAGGGCCAGGGTGG - Intergenic
1122010455 14:98742070-98742092 CTGTGGGCTGAGGGCTAGGGAGG - Intergenic
1122037703 14:98960693-98960715 CTGGGTGCAGAAGGCAAGGAAGG - Intergenic
1122509480 14:102254897-102254919 ATGTGTGGACATGGCTGGGAAGG - Intronic
1124400731 15:29345502-29345524 CTGTGTGCAGGGGGCCAGGTGGG - Intronic
1126055874 15:44729176-44729198 CTGGCTGCACTGGGCTGGGAAGG - Exonic
1126806063 15:52350553-52350575 CTGTGTGCACAAGGGCAGGGAGG + Intronic
1128353578 15:66908516-66908538 CTGTGTGCCCAGGACTGGGGTGG - Intergenic
1128747250 15:70123300-70123322 CAGTCTGCAGAGGGCTTGGAAGG - Intergenic
1129791289 15:78342102-78342124 CTCTGAGCACCGGGCTTGGAAGG + Intronic
1131101010 15:89690353-89690375 TTTCGTGCACGGGGCTAGGACGG + Intronic
1131970346 15:97886012-97886034 TTGTGTGCAAAGTCCTAGGAGGG - Intergenic
1132624878 16:886910-886932 CTGTGTGCTGGGGGCTGGGAAGG - Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133412653 16:5581012-5581034 CAGTGTGCACAGACCTGGGATGG + Intergenic
1133706776 16:8362238-8362260 TTGTGTGTGCAGGGCTGGGAAGG - Intergenic
1136519303 16:30786053-30786075 CTGTGTGCACAGGGGCAGTGGGG + Intronic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1137332300 16:47510522-47510544 CCGTGTGCCCAGAACTAGGAAGG + Intronic
1137433008 16:48433617-48433639 CTGTGTGGACAACGCAAGGAAGG - Intronic
1138550257 16:57743942-57743964 ATGTGTGCCCAGGACTAGGCAGG + Intronic
1141466906 16:84212271-84212293 CTGTGTCAACAGGGCGAGGAAGG - Intergenic
1141657562 16:85424210-85424232 CTGTGTTCACAGGACTGGGATGG + Intergenic
1142980426 17:3668239-3668261 CTGCGTGCGCAGGGCGGGGAGGG - Intronic
1143505817 17:7364525-7364547 CCCCGTGCACATGGCTAGGATGG - Intergenic
1144769389 17:17751149-17751171 GTGTGTGGCCAGTGCTAGGATGG + Intronic
1144888795 17:18481790-18481812 GTGTGTACACTGAGCTAGGATGG + Intronic
1144955738 17:19017989-19018011 CTGTGTGCAGAGGGCGGGGTGGG + Intronic
1145143412 17:20462508-20462530 GTGTGTACACTGAGCTAGGATGG - Intronic
1145250575 17:21294864-21294886 CTGAGGGCACACAGCTAGGAAGG + Intronic
1145792429 17:27636119-27636141 GTGTGTACACTGAGCTAGGATGG + Intronic
1145807314 17:27743992-27744014 GTGTGTACACTGAGCTAGGATGG + Intergenic
1147342915 17:39765646-39765668 CTGTGTTCACAGGGGTAGCCAGG - Exonic
1147934518 17:44004286-44004308 CTTTGAGCACAGGGCTGGGCAGG - Intronic
1148475652 17:47927015-47927037 CTGAGTGCTCAGGGCTGGCAAGG + Intronic
1148530624 17:48387328-48387350 GAGAGTGCACAGGGATAGGAGGG - Intronic
1148758172 17:49985516-49985538 CTGCCTCCACAGAGCTAGGATGG + Intergenic
1151596592 17:75081834-75081856 CAGTGTGCTCAGGGCTGGGCTGG + Intergenic
1152921916 17:83070092-83070114 CCGTGTGTGCAGGGCTGGGAGGG + Intergenic
1154376927 18:13818508-13818530 CTGGGTCCACATGGCTGGGAGGG + Intergenic
1156228982 18:35135825-35135847 CTGTGTGTACAGAGCTGAGATGG + Intronic
1156485927 18:37465601-37465623 CTGTGTGCCCAGAGCTGGGATGG + Intronic
1156658633 18:39318612-39318634 CTGTGTTCAGAGGGCTGGCAGGG - Intergenic
1156732647 18:40213118-40213140 GTGTGTTGCCAGGGCTAGGATGG - Intergenic
1157393825 18:47325621-47325643 CTGTGTGCCCAGGCCTGTGAAGG - Intergenic
1157712189 18:49857796-49857818 CTGTGTGCCCAGGGCTGCGCAGG - Intronic
1160389415 18:78518860-78518882 CTGTGCCCACAGAGCCAGGATGG + Intergenic
1161061504 19:2217419-2217441 CTGTGTGCACAGGGATGGAGAGG + Intronic
1161314391 19:3611129-3611151 CTCTGAGCACAGGGCCTGGAGGG - Exonic
1162341494 19:10093881-10093903 CTGTGGGCACAGGGATAGGGGGG + Intronic
1163927582 19:20360635-20360657 CTCTGTGCACAGACCCAGGAAGG + Intergenic
1164203441 19:23038394-23038416 GTGTGTGCACAGGGCTAATGGGG + Intergenic
1164810003 19:31148151-31148173 ATGTGTGCACAGTACTTGGAGGG - Intergenic
1165898083 19:39155364-39155386 CTGGGTGCTCAGGGCTGGCATGG + Intronic
1166868177 19:45853772-45853794 CAGTGTGGGCAGGGCTGGGATGG - Intronic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167271862 19:48510593-48510615 CTGTGGGCACAGGGCTGGGCTGG + Intronic
1167453874 19:49588358-49588380 CTGAGGTCACAGGGCTAGGAAGG + Intronic
925317191 2:2935588-2935610 CTGTGTGCAGAGGCCTTGGATGG - Intergenic
925999971 2:9322848-9322870 AAGTCTGCACAGGGCTTGGAGGG - Intronic
927862371 2:26568191-26568213 CTGTGGGGACAGGGCCAAGAGGG - Intronic
927885035 2:26713078-26713100 CTGTGGGCACTGGGCAAGGCAGG + Intronic
928352898 2:30578381-30578403 GTGTGTGCATAGGGCTTGAAGGG + Intronic
928420725 2:31136480-31136502 AGGTGTGCATAGGGCTAAGAGGG - Intronic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
930603484 2:53468800-53468822 CTGTGTGCACACACCAAGGAAGG - Intergenic
932385052 2:71324252-71324274 CTGTGTACACAGTGCTATCAGGG + Intronic
932627968 2:73314039-73314061 CAGGATGAACAGGGCTAGGAAGG + Intergenic
933390247 2:81657869-81657891 CTCTGTGCACAGACCAAGGAAGG - Intergenic
934769491 2:96898879-96898901 CTGTGTGCAGAGGGCAGGCAGGG + Intronic
935047733 2:99497403-99497425 CTCTGTGCACAGCCCAAGGAAGG + Intergenic
935374165 2:102378374-102378396 GTGTGTGTACAGCTCTAGGATGG + Intronic
936450701 2:112631953-112631975 TTGTGTGCACAGCTCTACGATGG + Intergenic
936478445 2:112862987-112863009 CTGATTGCTCAAGGCTAGGATGG - Intergenic
937057606 2:118952607-118952629 CTTTGTGCACAGACCAAGGAAGG - Intronic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
939115923 2:138060376-138060398 CTGTGGGCACATGGCCAGGCAGG - Intergenic
940775463 2:157878848-157878870 TTGTGTGCACAGGGCTTGTGTGG - Intronic
945719912 2:213407016-213407038 CTCTGTGCACAGACCAAGGAAGG + Intronic
945829241 2:214763292-214763314 CTGTGAGCACCGTGCTATGAAGG + Intronic
946019335 2:216630141-216630163 CTGTAGGCCCAGGGCTAGAACGG - Intergenic
947556769 2:231099919-231099941 CTCTGTGCACAGACCAAGGAAGG - Intronic
948072624 2:235140114-235140136 CTGTGTGCACAGGCCTGGGTTGG + Intergenic
1168823394 20:792513-792535 CTCTGCGCACAGAGCAAGGAAGG + Intergenic
1169064988 20:2690122-2690144 CTGTGGGCACTGGGGTAGGGAGG + Intergenic
1170870933 20:20205674-20205696 CTGTCTGACCTGGGCTAGGAAGG + Intronic
1173163477 20:40669878-40669900 CTGTGGACACAGGCCCAGGAGGG + Intergenic
1175160537 20:57004672-57004694 CTGTGTGGACAGGGCTCTGGTGG - Intergenic
1176098618 20:63355055-63355077 CTGTGGGCAGATGGCTGGGACGG + Intronic
1176239056 20:64067571-64067593 GGGTGTGGACAGAGCTAGGAGGG - Intronic
1176245780 20:64095825-64095847 CTAAGAGGACAGGGCTAGGATGG - Intronic
1178836757 21:36104961-36104983 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1180971059 22:19815974-19815996 CTGTGTGCACAGGGCTAGGAGGG - Intronic
1181629801 22:24144718-24144740 CAGTCTGAACAGGCCTAGGATGG - Intronic
1182772086 22:32803158-32803180 GTGTGTGCACTGGGCTGGGCTGG + Intronic
1182923755 22:34103726-34103748 CTGTCTGAACAGGGCTAGACTGG + Intergenic
1183225751 22:36548865-36548887 CTGGGTGGACTGGGCTGGGAAGG + Intergenic
1183744447 22:39684973-39684995 CTGTGTGCCCGTGGGTAGGAGGG - Intronic
1184154085 22:42655740-42655762 CAGTGTGCCCAGGGCTAGACTGG + Intergenic
1184781732 22:46653031-46653053 CCGTGTGCTCAGAGATAGGAAGG + Intronic
1184834937 22:47015533-47015555 CTGTGCTCACAGAGCTATGATGG - Intronic
949929736 3:9069354-9069376 CAGTGTGCCCAGGGCTGGGAAGG + Intronic
950575431 3:13829511-13829533 GAGTGCGCACAGGGCTAGAAGGG + Intronic
950846896 3:16023506-16023528 CTCTGTGCACAGACCAAGGAAGG - Intergenic
950935405 3:16834349-16834371 GTGTGTGCAAAGGGCAAGGCTGG - Intronic
953828963 3:46278826-46278848 CTGTATGGACAGGGTTTGGATGG - Intergenic
954604412 3:51897649-51897671 CTCTGTGCACAGACCAAGGAAGG + Intronic
954638936 3:52086647-52086669 CTGTCTGCAGAGGGCTAGGCTGG - Intronic
954972585 3:54663742-54663764 TGGTGTGCACATGGCAAGGAAGG - Intronic
955200896 3:56851249-56851271 CTGAATCCACAGTGCTAGGAGGG - Intronic
955879310 3:63526874-63526896 CTGTGTGCTCAGAGCTCAGATGG + Intronic
956865083 3:73361657-73361679 CTGTGTGCCCTAGGCTAGAAGGG + Intergenic
959498292 3:107076334-107076356 CTGTGTGGACAGGGCTACTGTGG + Intergenic
959581586 3:107988312-107988334 GTGTGAGGACATGGCTAGGAAGG - Intergenic
960581034 3:119279171-119279193 CTGTGTGCCCAGAGCTGGGGAGG + Intergenic
960720836 3:120623059-120623081 CTCTGTGCACAGACCAAGGAAGG - Intergenic
960989781 3:123303029-123303051 CTGGGTGCACAGGGGCTGGAAGG - Intronic
961469159 3:127100695-127100717 CTGTGCGCTCAGGACCAGGACGG - Intergenic
961531047 3:127540659-127540681 CTGTGTGGACAGGGTTTGGGTGG + Intergenic
966618996 3:181944089-181944111 CTGTGTACATAGGGCTGGGGGGG - Intergenic
966854331 3:184183906-184183928 CTGTGGCCACAGGGGTGGGAAGG - Exonic
968433338 4:572314-572336 GTGTATGCAGAGGGATAGGACGG + Intergenic
968433367 4:572450-572472 GTGTGTCCACAGTGATAGGACGG + Intergenic
970093015 4:12430877-12430899 CTCTGTGCACAGACCAAGGAAGG - Intergenic
971158609 4:24109753-24109775 TTGTAAGCAAAGGGCTAGGAAGG + Intergenic
974345142 4:60669664-60669686 TTGTTTGTACATGGCTAGGAGGG - Intergenic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
976072218 4:81254453-81254475 CTGGGTACACAGGGACAGGAAGG - Intergenic
976657304 4:87502791-87502813 CTTTATGGACAGGGCTTGGAGGG + Intronic
976846673 4:89496516-89496538 CTGTGTGCAGTGGGCTAAGAAGG + Intergenic
977282902 4:95064486-95064508 TTGTATGCACAGGGGTGGGAGGG - Intronic
977390158 4:96399020-96399042 CTGTGTGGACAGGGGAAAGAAGG - Intergenic
977515304 4:98014537-98014559 TTATGTGCACAGGGCCAAGATGG - Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
978835588 4:113145815-113145837 CAGAGTGCAGAGGGCAAGGACGG + Intronic
980495768 4:133586500-133586522 CTTTTTGCAGAGGGCTATGAGGG - Intergenic
981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG + Intronic
981374451 4:143997483-143997505 CAGTGTGAACAGCTCTAGGAGGG - Intronic
981759105 4:148173875-148173897 CTGTGTGGAGAGGGCTGGGGAGG + Intronic
982140560 4:152313644-152313666 CTGTGTGCTCAGTGCAAGGTGGG + Intergenic
983744900 4:171186053-171186075 TTTTGTGAACAGGGCTTGGAAGG + Intergenic
984653338 4:182291869-182291891 CTGTGTGTGTAGGGCTGGGAGGG + Intronic
986073650 5:4312465-4312487 CTGTTTGCACAGTGAAAGGAAGG - Intergenic
986294370 5:6424694-6424716 GTGTGTGCCCAGGGCAAGAATGG + Intergenic
987072859 5:14354153-14354175 CTGTCTGAGCAGGGCTGGGAGGG + Intronic
989615838 5:43335889-43335911 CTCTGTGCACAGACCAAGGAAGG - Intergenic
990274172 5:54177782-54177804 CTGTGTGCACAGGAACAGGGTGG - Intronic
994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG + Intergenic
996099928 5:119435780-119435802 CTCTGTGCACAGACCAAGGAAGG + Intergenic
998552897 5:143094272-143094294 CTCTGTGCACAGACCAAGGAAGG - Intronic
998606608 5:143641818-143641840 CTGAGTGCACAGGGAAATGAGGG + Intergenic
1001236094 5:170030864-170030886 CTGTGGGCACATGGCTTGGATGG + Intronic
1002295345 5:178227634-178227656 ACATGTGCACAGGGCTGGGAAGG + Intronic
1003311767 6:4975151-4975173 CTTTGTGCACAGGGCTTTGTGGG - Intergenic
1003538927 6:7001297-7001319 CTCTGTTCACAAGGCTAGGTGGG - Intergenic
1003750742 6:9052416-9052438 CTGTGTGAGCAGGGCTAAAAGGG + Intergenic
1004354855 6:14921951-14921973 TTGTTTAAACAGGGCTAGGATGG + Intergenic
1005849839 6:29813203-29813225 CTGTCTGCTCAGAGCTGGGAGGG - Intergenic
1005923249 6:30418668-30418690 CTGGCTGCTCAGGGCTCGGAGGG + Intergenic
1006060401 6:31414535-31414557 CTGCCTGCTCAGGGCTGGGAGGG + Intronic
1006072844 6:31509307-31509329 CTGCCTGCTCAGGGCTGGGAGGG + Intronic
1006985995 6:38176020-38176042 CTGTCTGCACAGTGCTGGCACGG - Intronic
1007406643 6:41639370-41639392 GTGTGTGCACAGGGCAGGGGCGG - Intronic
1007479210 6:42139051-42139073 CTGTTTGCACAAGGGTAGGCTGG - Intronic
1007755702 6:44097895-44097917 CTGTGTGCAGAGGCCAGGGAGGG - Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1011133496 6:84075255-84075277 CTGACTGCCCAGGGCTGGGAAGG + Intronic
1013009085 6:106103938-106103960 CTGTCTGCACATCGCGAGGAAGG + Intronic
1013857591 6:114592637-114592659 CTGTGTGAACAAGTCTAGGATGG + Intergenic
1016474064 6:144406955-144406977 CTGTGTGCAAAGGCCAGGGAGGG - Intronic
1017608799 6:156162444-156162466 CTGCGTTCACAAGGCAAGGAAGG + Intergenic
1018027974 6:159820355-159820377 CTGAGTGCACGGGGCTGGGAAGG + Intronic
1018137032 6:160788923-160788945 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1018191715 6:161314886-161314908 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1018299812 6:162389184-162389206 TGGTGTGCGCAGGGCTGGGATGG + Intronic
1019149460 6:169994396-169994418 CTGTGACCACGGGGCTCGGAAGG - Intergenic
1019497560 7:1347579-1347601 GTGTGTGCCCAGGGCCAGGCGGG - Intergenic
1019573715 7:1726184-1726206 CGGTGGCCACAGGGCAAGGAGGG - Intronic
1019724072 7:2591295-2591317 GTGTGACCACAGGGCTGGGAAGG + Intronic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1023115146 7:36855236-36855258 ATGCCTGCAGAGGGCTAGGATGG + Exonic
1023436732 7:40147593-40147615 CTCTGTGCACAGACCAAGGAAGG - Intronic
1023617316 7:42033088-42033110 CGGTGTGCACAGAGCTGGGCAGG + Intronic
1023798578 7:43813949-43813971 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1028793416 7:94878423-94878445 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1030524309 7:110635199-110635221 CTGTGGGCACATAGGTAGGATGG - Intergenic
1032389405 7:131546255-131546277 CTGGGATCCCAGGGCTAGGAGGG + Intronic
1032638652 7:133739704-133739726 CTGTGTGTTTAGGGCTAGGGTGG - Intronic
1034545016 7:151783965-151783987 CTGTGTGTGCAGGTCTAGGGTGG + Intronic
1035126082 7:156608310-156608332 CCGTGTGTTCAGGGCCAGGAAGG - Intergenic
1035273793 7:157735459-157735481 CTGTGTGCAGCGGCCCAGGAAGG + Intronic
1035274137 7:157737382-157737404 CTGAGTGCGCTGGGCTTGGAGGG + Intronic
1035708814 8:1697084-1697106 CTGCGGGCACAGGGCTGGGGAGG - Intronic
1036105155 8:5830296-5830318 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1039641191 8:39225148-39225170 GGGTGTGCACAGGGTTGGGAGGG - Intronic
1040621212 8:49095258-49095280 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1040694646 8:49980986-49981008 CTGTGTGCATGGGGCTCAGAAGG - Intronic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1042634862 8:70862866-70862888 CTGTGTACTCAGGCCAAGGAAGG + Intergenic
1042961804 8:74311274-74311296 CTGTCTGCACTGGGCTAGGTGGG + Intronic
1043142643 8:76609032-76609054 AGGTGTGCACATGGCTAGGGAGG - Intergenic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1044482678 8:92711114-92711136 CTGAGTGGACAGTGTTAGGAAGG + Intergenic
1045375082 8:101564431-101564453 ATGTGTGCACAGTGGTAGCAGGG + Intronic
1047740239 8:127800880-127800902 CTGTGGGAACAGGCCTAGCAGGG + Intergenic
1047776326 8:128073681-128073703 CTGTGTGAGGAGGGCTAGGGAGG - Intergenic
1048724301 8:137364420-137364442 CTATGTGCACAGGGCTCTAACGG - Intergenic
1049407549 8:142458342-142458364 CAGTCTGCACAGGCCCAGGATGG + Intronic
1049461715 8:142732638-142732660 CTCTGTGCACAGACCAAGGAAGG - Intronic
1049689489 8:143952501-143952523 CTTTGGGCACAGGGCTGGGCAGG - Intronic
1051875837 9:21792343-21792365 CCTTGTGCACAGTGGTAGGAAGG + Intergenic
1053434061 9:38063592-38063614 GTGTGTGCACAGGGTTGGGAGGG - Intronic
1055249422 9:74284473-74284495 CTATGTGCAAAGGTTTAGGATGG + Intergenic
1056415010 9:86367284-86367306 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1056931370 9:90880724-90880746 CTGTGTGGGCAGGGCCAGGTAGG + Intronic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1060151496 9:121291789-121291811 CAGTGTCCACAGGGATAGAATGG - Intronic
1060431004 9:123551562-123551584 CTGTGTGTAAAGGGCTAGTGAGG + Intronic
1061724735 9:132575890-132575912 CTGTTTCCACAGGCCTAGGGAGG + Intergenic
1188002150 X:24993324-24993346 CTCTGTGGACAGGGATGGGATGG + Intronic
1189034150 X:37479030-37479052 CTCTGTGCACAGACCAAGGAAGG + Intronic
1189803561 X:44714084-44714106 CTGCCTGCACTGAGCTAGGATGG - Intergenic
1191890251 X:65932222-65932244 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1192179848 X:68909555-68909577 CTGTGGGAAAAGGGCTGGGATGG + Intergenic
1195613555 X:106895187-106895209 CTGTGGGCACAGGGCTACCAGGG - Intronic
1196860265 X:120020579-120020601 CACTTTGCACAGGGCTAGGGTGG + Intergenic
1199637266 X:149825746-149825768 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1199637770 X:149829861-149829883 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1200224383 X:154409183-154409205 CTGCCTGAATAGGGCTAGGAGGG + Exonic
1200885025 Y:8259033-8259055 TAGAGTACACAGGGCTAGGATGG + Intergenic
1201900272 Y:19041390-19041412 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1202573393 Y:26295871-26295893 CTGTGTGCTCTGGTCTTGGATGG - Intergenic