ID: 1180972860

View in Genome Browser
Species Human (GRCh38)
Location 22:19824681-19824703
Sequence CTCTGGGTGTGGGGACCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180972851_1180972860 -1 Left 1180972851 22:19824659-19824681 CCAAGAGGGGTCCAGAGCGCTCC 0: 1
1: 0
2: 3
3: 9
4: 161
Right 1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG No data
1180972850_1180972860 0 Left 1180972850 22:19824658-19824680 CCCAAGAGGGGTCCAGAGCGCTC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG No data
1180972848_1180972860 11 Left 1180972848 22:19824647-19824669 CCCAGGGCTCTCCCAAGAGGGGT 0: 1
1: 0
2: 3
3: 21
4: 169
Right 1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG No data
1180972846_1180972860 12 Left 1180972846 22:19824646-19824668 CCCCAGGGCTCTCCCAAGAGGGG 0: 1
1: 0
2: 2
3: 33
4: 271
Right 1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG No data
1180972849_1180972860 10 Left 1180972849 22:19824648-19824670 CCAGGGCTCTCCCAAGAGGGGTC 0: 1
1: 0
2: 5
3: 21
4: 195
Right 1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180972860 Original CRISPR CTCTGGGTGTGGGGACCAGC GGG Intronic
No off target data available for this crispr