ID: 1180980531

View in Genome Browser
Species Human (GRCh38)
Location 22:19876195-19876217
Sequence CCCCCAAGATGCCTGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180980531_1180980545 26 Left 1180980531 22:19876195-19876217 CCTGTCCACAGGCATCTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1180980545 22:19876244-19876266 CCTCAGCCCCGGGGGAGAGATGG 0: 1
1: 0
2: 4
3: 46
4: 343
1180980531_1180980541 17 Left 1180980531 22:19876195-19876217 CCTGTCCACAGGCATCTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1180980541 22:19876235-19876257 TGGTCTCCACCTCAGCCCCGGGG 0: 1
1: 1
2: 2
3: 19
4: 181
1180980531_1180980542 18 Left 1180980531 22:19876195-19876217 CCTGTCCACAGGCATCTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1180980542 22:19876236-19876258 GGTCTCCACCTCAGCCCCGGGGG 0: 1
1: 0
2: 0
3: 18
4: 192
1180980531_1180980540 16 Left 1180980531 22:19876195-19876217 CCTGTCCACAGGCATCTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1180980540 22:19876234-19876256 CTGGTCTCCACCTCAGCCCCGGG 0: 1
1: 1
2: 3
3: 64
4: 427
1180980531_1180980539 15 Left 1180980531 22:19876195-19876217 CCTGTCCACAGGCATCTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1180980539 22:19876233-19876255 CCTGGTCTCCACCTCAGCCCCGG 0: 1
1: 0
2: 1
3: 58
4: 438
1180980531_1180980535 -3 Left 1180980531 22:19876195-19876217 CCTGTCCACAGGCATCTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1180980535 22:19876215-19876237 GGGGAGCCCACTGCTCTGCCTGG 0: 1
1: 1
2: 22
3: 167
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180980531 Original CRISPR CCCCCAAGATGCCTGTGGAC AGG (reversed) Intronic
900739871 1:4324244-4324266 CCCAGAGGATGCCTGGGGACCGG + Intergenic
901852096 1:12022205-12022227 CCCACCAGATGCCTGTCGAGGGG + Exonic
902694119 1:18128886-18128908 ACCCCAGGATACCTCTGGACAGG + Intronic
902872428 1:19322543-19322565 CCCTCAAGTTTCCTGAGGACAGG - Intronic
903046287 1:20566520-20566542 CACCAGGGATGCCTGTGGACAGG - Intergenic
905126625 1:35719881-35719903 CACCCATGATGCCTGTGAAGTGG + Intergenic
905183040 1:36178272-36178294 CGCCAGAGATGCCTGAGGACTGG + Intronic
905275809 1:36817233-36817255 CACCAATGATGCGTGTGGACAGG + Exonic
906533638 1:46539041-46539063 CCCCCAAACTGCTTGTGGACTGG - Intergenic
911072180 1:93840983-93841005 CCCCCAAGATGCTTATTGTCTGG + Intronic
913566706 1:120080061-120080083 CCCCCAGCATGTCTGGGGACTGG - Intergenic
913631425 1:120713491-120713513 CCCCCAGCATGTCTGGGGACTGG + Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
922330952 1:224575039-224575061 TCACCATGATGCCTTTGGACTGG - Intronic
1062860561 10:806303-806325 CCCCCAAGGTGCATGGTGACTGG - Intergenic
1063008467 10:1997491-1997513 CCCCCAGGATGCCAGTGGCAGGG - Intergenic
1064707308 10:18086323-18086345 CCCAGAAGATGCCTGTGAGCTGG + Intergenic
1066037552 10:31508639-31508661 CCACCAAGGGGCCTGAGGACAGG - Intronic
1066493233 10:35915393-35915415 CCCCACAGATGCCTCTGCACAGG - Intergenic
1067663594 10:48255071-48255093 CCCCCAAAATGCCCATTGACTGG - Intronic
1069512312 10:69051646-69051668 CCCCCAAAATTCATGTGTACTGG - Intergenic
1073070111 10:100787926-100787948 CCCCAAAGATAGCTGTGGAGTGG - Intronic
1075731518 10:124639326-124639348 TCCCCAAGAGGGCTGAGGACAGG + Intronic
1076704628 10:132294354-132294376 CCCCAAAGATGCCTTGGGGCGGG - Intronic
1078241117 11:9531426-9531448 CCTCACAGATGCCTGTGGGCAGG - Intergenic
1080699290 11:34630886-34630908 CCCCCATGAAGCCAGTGGTCTGG + Intronic
1084084227 11:66847549-66847571 CCCCCACGATGCCTGCAGGCTGG + Intergenic
1084386142 11:68843749-68843771 GCCCCAAGAGGCCAGTGGGCTGG + Intronic
1084957179 11:72697638-72697660 CCCCCTGGATGGCTGTGGAGGGG + Exonic
1085338813 11:75718135-75718157 CCCCCAAGAAGCCTCTGGGCAGG - Intronic
1086169142 11:83815763-83815785 CCCCCATGAGGCCTGTGTGCAGG - Intronic
1091970247 12:4780631-4780653 CAGCCAAGATGCCTGTGGCAGGG + Intronic
1092529791 12:9334909-9334931 CCTCCAAGATGGCTGAGGTCTGG + Intergenic
1099735126 12:86557505-86557527 CCACCATGGTGCCTGAGGACTGG + Intronic
1100712768 12:97275641-97275663 GCCCCAAGATGCCTGGAGTCTGG - Intergenic
1104525518 12:129517119-129517141 CCCCAAATATGCCTGTGTCCGGG - Intronic
1104955759 12:132465168-132465190 CCCTCAAGTTGCATGGGGACTGG - Intergenic
1104955795 12:132465320-132465342 CCCTCAAGTTGCATGGGGACTGG - Intergenic
1114339327 14:21726685-21726707 GCCCCAAGAAGCCTATAGACTGG - Intergenic
1117441071 14:55759921-55759943 ACCCCAAGATACCTGTTGAGGGG + Intergenic
1118036820 14:61877175-61877197 CTCCCAGGAAGCCTGGGGACTGG + Intergenic
1121033235 14:90676901-90676923 TCCTCCAGATGCCTGTCGACAGG - Intronic
1121319391 14:92982200-92982222 ACCCCAAGATCCCTGTGGCCGGG + Intronic
1121784757 14:96649161-96649183 CCACCAAGAAGCCTGAGGACAGG - Intergenic
1122272533 14:100574683-100574705 CCCCCAAGGTGCCTGGAGAGGGG - Intronic
1128207155 15:65862991-65863013 CTCCCAGAATTCCTGTGGACTGG - Intronic
1128712225 15:69880600-69880622 CCCCCAAGATGCCTCTGGCTGGG + Intergenic
1129787583 15:78319932-78319954 CCCCCAAAATGACTGTGGCAGGG + Intergenic
1130256862 15:82329863-82329885 CTGCCAAGCTGCCTGTGCACTGG + Intergenic
1130598086 15:85260125-85260147 CTGCCAAGCTGCCTGTGCACTGG - Intergenic
1131672457 15:94633883-94633905 CCCCCAAGTTGAGGGTGGACGGG + Intergenic
1131968419 15:97869467-97869489 ACCCCAAGCTGCCTGCTGACGGG - Intergenic
1132241248 15:100258914-100258936 TCACCAAGATGACTGTTGACAGG - Intronic
1132601600 16:775370-775392 CCCCCAGGACTCCTGTGGCCGGG + Intronic
1133825287 16:9272955-9272977 CCCCCAGGCAGCCTGTGGCCTGG + Intergenic
1134096245 16:11420840-11420862 CCCCGATTATGCCTGTGTACTGG + Intronic
1134136785 16:11681781-11681803 GCTCCAAGATGCCTCTGCACAGG + Intronic
1134681775 16:16131509-16131531 GCCCCAAGAGGGCTGGGGACAGG + Intronic
1136540685 16:30926213-30926235 CCCCCAAGATGTCTCTGTGCAGG + Intronic
1139506047 16:67398600-67398622 GCCCCAGGAGGGCTGTGGACAGG + Exonic
1139581546 16:67876799-67876821 CCCCCAACATCCCTGGGGATGGG - Intronic
1140272233 16:73477605-73477627 CCACCATGATGCCTGTTGGCAGG - Intergenic
1143241229 17:5444778-5444800 CACCCAACCTGCCTGTGGTCTGG - Intronic
1143495879 17:7312338-7312360 CCTCCCAGATGCCTGAGGAGGGG - Exonic
1146906884 17:36623693-36623715 CCCCCAGGATGCCTGAGCAGGGG - Intergenic
1148121639 17:45216110-45216132 TCCCCAAGCTGCCTGAGAACTGG - Intergenic
1150858334 17:68774624-68774646 GCCTCCAGATGCCTGTGGGCAGG - Intergenic
1152472560 17:80498543-80498565 CCTCCAGGATTCCTGTGGTCGGG + Intergenic
1152738703 17:82009616-82009638 CCCCCGTGAGGTCTGTGGACGGG + Intronic
1153296679 18:3552819-3552841 CCCACAAAATGCATGTGGATGGG - Intronic
1156042895 18:32843409-32843431 CCCACAAGATGCTTCTGGGCTGG + Intergenic
1157788381 18:50507293-50507315 CCCTCAAGTGGCCTGTGGGCTGG - Intergenic
1160667216 19:336573-336595 CCCCCATTCTGTCTGTGGACTGG - Intronic
1162795170 19:13083268-13083290 CCCCCAAGGGGCCTGGGGTCTGG + Intronic
1163427730 19:17248233-17248255 CCACCAGGTTGCCTGTGGAGGGG - Intronic
1163654584 19:18538367-18538389 CCCTGAAGACGGCTGTGGACGGG - Exonic
1165004220 19:32791333-32791355 TTTCCAGGATGCCTGTGGACAGG + Intronic
1165087424 19:33360826-33360848 TCACCACGATGCCTTTGGACTGG + Intergenic
1167211668 19:48137476-48137498 TCCCCAAGATGTCTGGGGTCCGG + Intronic
1168450877 19:56465786-56465808 CTCCCAAGAGGCCTGTGTGCAGG + Intronic
925189598 2:1872116-1872138 GCCCCAAGAAGCCTGGGGACTGG + Intronic
928132933 2:28666426-28666448 CCCCTATAATGCATGTGGACTGG + Intergenic
937127394 2:119483185-119483207 CCCCAGGGATGCCTGGGGACAGG + Intronic
938555845 2:132423544-132423566 CCCCCATGCTGCCTGTGTATGGG + Intronic
939251097 2:139682548-139682570 CCCCCAAGATACATGAAGACAGG + Intergenic
943066192 2:183089296-183089318 CACCCAAAATACCTCTGGACAGG + Intronic
1171408212 20:24928144-24928166 CCCCCAAAAAGCCTGTGGTCAGG + Intergenic
1172162838 20:32880207-32880229 ACCCCAGGCTGCCTGAGGACCGG - Intronic
1172783810 20:37452596-37452618 CTCTCAAGATGCCCGTGGTCTGG - Intergenic
1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG + Intergenic
1174803096 20:53581585-53581607 CGCCCACCATGTCTGTGGACGGG - Exonic
1175030427 20:55948037-55948059 CTCCCAAGAAGGCTGTGGAGAGG + Intergenic
1175755587 20:61527777-61527799 CACCCGAGATGCCTCTGGAAGGG - Intronic
1179635516 21:42706088-42706110 CCCACAACATGCATGTGGAGAGG + Intronic
1179943629 21:44655612-44655634 CCCCCAAGCTGCCTCTGCAGGGG - Intronic
1179947020 21:44685426-44685448 CCCCCAAGCTGCCTCTGCAGGGG + Intronic
1180980531 22:19876195-19876217 CCCCCAAGATGCCTGTGGACAGG - Intronic
1182417767 22:30232553-30232575 CCCCGAACCTGCCTGTGCACGGG + Intergenic
1182515305 22:30855346-30855368 CCCACCAGATGACTGTGGGCCGG + Intronic
1182834847 22:33333509-33333531 CCCCCAACATGCCTGTGCTCTGG + Intronic
950459976 3:13115402-13115424 CCCCCATGATGTCTCTTGACAGG + Intergenic
951822835 3:26832645-26832667 CCACCAAGATTTCTGTGCACTGG + Intergenic
953432846 3:42854028-42854050 CAGCCAAGAAGCCTATGGACAGG - Intronic
953574330 3:44101035-44101057 CCCTGAAGACGCCTGGGGACAGG + Intergenic
954745509 3:52785387-52785409 CCCCCAGGATGCCTGTGTGGAGG - Intronic
954997605 3:54895913-54895935 CTCCCAAGATCTCTGAGGACAGG - Intronic
956309541 3:67863812-67863834 ACCCCAACATCCCTGTGGAAAGG - Intergenic
956939124 3:74136548-74136570 TCACCAAGATGCCTTTGGACTGG - Intergenic
961664908 3:128488916-128488938 CCCCCAAAATGCCTTTGTCCTGG - Intronic
969175997 4:5399538-5399560 GCCCCAAGATGCCTGGGGCATGG + Intronic
969521064 4:7678004-7678026 CATCACAGATGCCTGTGGACAGG - Intronic
969570277 4:8004282-8004304 CCCCCAACCTGCCTGTGGCTTGG - Intronic
972415255 4:38832951-38832973 CCTCCAAGGGGCCTGAGGACAGG + Intronic
972843686 4:42961777-42961799 CTGCCAAGATGCACGTGGACAGG - Intronic
974902970 4:68023532-68023554 ACACCAACATGCCTGTAGACTGG - Intergenic
982814678 4:159869848-159869870 CCCCCAAAAAGCCTGGGCACAGG - Intergenic
983302529 4:165945793-165945815 ACCCCAAGATACCTGTCCACAGG + Intronic
983489638 4:168373307-168373329 CCCCAAAGATCCATGTGGTCTGG + Intronic
984305555 4:177984796-177984818 CCCCCAAGAAGACTGAAGACTGG + Intronic
989723686 5:44561105-44561127 CCCCCAAGATTCCTGTCCTCTGG + Intergenic
997359954 5:133288716-133288738 GCCCCAAGGTGCCTGTGAAAAGG + Intronic
997629677 5:135357306-135357328 CCCCCACTATGGCTGAGGACTGG - Intronic
999971214 5:156865469-156865491 CCCCCAAGTTGCCTGGGAATGGG - Intergenic
1002898852 6:1394084-1394106 CCACGAAGATGCCTGCGGAGGGG + Intronic
1006301634 6:33196518-33196540 CCGAGGAGATGCCTGTGGACAGG - Exonic
1006432940 6:34009140-34009162 CCCCCAAGAAGCTTATGGTCTGG + Intergenic
1006720319 6:36145775-36145797 CCCCAAAGAGCCCTGTGGACTGG + Intergenic
1012903515 6:105036640-105036662 CTCCCAAGATGCCATTGGAATGG + Intronic
1013654470 6:112231241-112231263 CCTCCAAGATGACTGGGGAGTGG - Intronic
1016110720 6:140219762-140219784 CCCCCAAGATGGCTGTCTAGAGG - Intergenic
1016357000 6:143228729-143228751 GCCCCAAGATGGGTGTGGTCTGG + Intronic
1016900639 6:149097387-149097409 CCCCACAGATGCCTGTAGAAGGG - Intergenic
1017745425 6:157442966-157442988 AACCCAAGAGGCCTGGGGACAGG - Intronic
1018491547 6:164298975-164298997 CGCCCTAAATGCATGTGGACAGG + Intergenic
1018824315 6:167397775-167397797 CCCACATGAGGCCTGGGGACTGG + Intergenic
1023935483 7:44737070-44737092 CCACCCAGCTGCCTCTGGACTGG - Intergenic
1025095419 7:56092232-56092254 TTCCCAAGACCCCTGTGGACAGG + Intronic
1027197023 7:76037626-76037648 CCTACAAGAAGCCTGTGGTCAGG - Intronic
1032709322 7:134448424-134448446 TCACCACGATGCCTTTGGACTGG + Exonic
1034251051 7:149691051-149691073 CACCCAAGTGGCTTGTGGACTGG - Intergenic
1035222607 7:157415006-157415028 CCCCCAAGAGGGCTGTGAGCAGG + Intronic
1037845526 8:22278645-22278667 CCCCCAACCAGCCTGTGGCCTGG - Intronic
1049494918 8:142925358-142925380 CAACCAAAATGCCTGTTGACTGG + Intergenic
1049779557 8:144422586-144422608 CCGCCAAGAAGCCGGAGGACTGG - Intergenic
1053207956 9:36203805-36203827 CCACTAAGATGTCAGTGGACTGG + Intronic
1057083011 9:92186935-92186957 CCCAGAAGATGTCTGTGCACCGG - Intergenic
1057309911 9:93935805-93935827 CAACCAAGATGCCTATGGATAGG + Intergenic
1057409477 9:94804956-94804978 CCACCTTGAGGCCTGTGGACCGG - Intronic
1059316099 9:113426960-113426982 CCTCCTAGATGCCTTTGCACAGG - Intronic
1060360214 9:122948962-122948984 CCCCCAAACTACTTGTGGACAGG - Intronic
1061299845 9:129698111-129698133 CCCCGAAGCTGCCTGGGGACGGG - Intronic
1189763222 X:44343668-44343690 CCCCCACGTTGCCTGGAGACGGG + Exonic
1196472469 X:116044082-116044104 TCACCATGATGCCTTTGGACTGG - Intergenic
1198093909 X:133359265-133359287 CCCTCAAGATGCCTGGAGACTGG + Intronic
1199862282 X:151812056-151812078 CCCCCAAGATACCTGTTCCCTGG - Intergenic