ID: 1180980758

View in Genome Browser
Species Human (GRCh38)
Location 22:19877005-19877027
Sequence GGCTGGCTCTGTTTGAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 240}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180980758_1180980771 17 Left 1180980758 22:19877005-19877027 CCTGTCCTCAAACAGAGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1180980771 22:19877045-19877067 TCTGGCCTCCGAGGAGCTGGCGG 0: 1
1: 0
2: 5
3: 28
4: 298
1180980758_1180980770 14 Left 1180980758 22:19877005-19877027 CCTGTCCTCAAACAGAGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1180980770 22:19877042-19877064 GGGTCTGGCCTCCGAGGAGCTGG 0: 1
1: 0
2: 0
3: 49
4: 759
1180980758_1180980768 8 Left 1180980758 22:19877005-19877027 CCTGTCCTCAAACAGAGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1180980768 22:19877036-19877058 ATACCTGGGTCTGGCCTCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1180980758_1180980760 -7 Left 1180980758 22:19877005-19877027 CCTGTCCTCAAACAGAGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1180980760 22:19877021-19877043 GCCAGCCCCACCTGCATACCTGG 0: 1
1: 0
2: 2
3: 32
4: 787
1180980758_1180980773 21 Left 1180980758 22:19877005-19877027 CCTGTCCTCAAACAGAGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1180980773 22:19877049-19877071 GCCTCCGAGGAGCTGGCGGCGGG 0: 1
1: 0
2: 2
3: 20
4: 282
1180980758_1180980765 -1 Left 1180980758 22:19877005-19877027 CCTGTCCTCAAACAGAGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1180980765 22:19877027-19877049 CCCACCTGCATACCTGGGTCTGG 0: 1
1: 0
2: 2
3: 17
4: 175
1180980758_1180980772 20 Left 1180980758 22:19877005-19877027 CCTGTCCTCAAACAGAGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1180980772 22:19877048-19877070 GGCCTCCGAGGAGCTGGCGGCGG 0: 1
1: 0
2: 7
3: 50
4: 357
1180980758_1180980762 -6 Left 1180980758 22:19877005-19877027 CCTGTCCTCAAACAGAGCCAGCC 0: 1
1: 0
2: 2
3: 23
4: 240
Right 1180980762 22:19877022-19877044 CCAGCCCCACCTGCATACCTGGG 0: 1
1: 0
2: 1
3: 38
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180980758 Original CRISPR GGCTGGCTCTGTTTGAGGAC AGG (reversed) Intronic