ID: 1180980769

View in Genome Browser
Species Human (GRCh38)
Location 22:19877039-19877061
Sequence GCTCCTCGGAGGCCAGACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180980769_1180980780 17 Left 1180980769 22:19877039-19877061 CCTGGGTCTGGCCTCCGAGGAGC 0: 1
1: 0
2: 0
3: 25
4: 227
Right 1180980780 22:19877079-19877101 TGTGCCCTGGCCTGCAGGGATGG 0: 1
1: 0
2: 4
3: 39
4: 499
1180980769_1180980778 13 Left 1180980769 22:19877039-19877061 CCTGGGTCTGGCCTCCGAGGAGC 0: 1
1: 0
2: 0
3: 25
4: 227
Right 1180980778 22:19877075-19877097 ACCGTGTGCCCTGGCCTGCAGGG 0: 1
1: 1
2: 2
3: 12
4: 180
1180980769_1180980777 12 Left 1180980769 22:19877039-19877061 CCTGGGTCTGGCCTCCGAGGAGC 0: 1
1: 0
2: 0
3: 25
4: 227
Right 1180980777 22:19877074-19877096 CACCGTGTGCCCTGGCCTGCAGG 0: 1
1: 0
2: 4
3: 19
4: 238
1180980769_1180980776 4 Left 1180980769 22:19877039-19877061 CCTGGGTCTGGCCTCCGAGGAGC 0: 1
1: 0
2: 0
3: 25
4: 227
Right 1180980776 22:19877066-19877088 GGCGGGCGCACCGTGTGCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180980769 Original CRISPR GCTCCTCGGAGGCCAGACCC AGG (reversed) Exonic
900375073 1:2350549-2350571 GCTCCTGGGAGGCCTGTCCCTGG + Intronic
900466292 1:2827051-2827073 GCTACTGGAAGGCCAGCCCCAGG + Intergenic
900633996 1:3652844-3652866 TCTCCTCGCAGGCTAGACTCTGG - Intronic
900769530 1:4529502-4529524 CCTCCTCGGATGCCAAGCCCAGG + Intergenic
902237508 1:15067056-15067078 GCCCCTCGGAGAACAGACTCAGG - Intronic
902286773 1:15412219-15412241 GCTCCTGGGTGGGCAGACGCAGG + Intronic
902549753 1:17212267-17212289 GCTCCTGGCAGGCCAGATCCTGG + Intronic
902701982 1:18178771-18178793 TCCTCTGGGAGGCCAGACCCTGG - Intronic
902923507 1:19680870-19680892 GCCCCTCAGAGGCCAGCCGCCGG - Intergenic
903761270 1:25700541-25700563 GCTCCTCGGAGAGAAGACACAGG + Intronic
903815412 1:26060932-26060954 GCTCCCCTGTGGCCACACCCAGG + Intronic
904613430 1:31737440-31737462 GATCCTCGTGGGCCAGTCCCGGG - Exonic
904624047 1:31792290-31792312 GCTCCACAGAGGCCAGCCCGTGG + Exonic
906702820 1:47872230-47872252 TATCCTGGGAGGCCAGACACAGG - Intronic
907527721 1:55063554-55063576 GCTCCTGGGAGGCCTGCGCCAGG - Exonic
907861814 1:58361196-58361218 GGCCCTAGGAGGCCAGACCCAGG - Intronic
908293103 1:62687932-62687954 GCTCCTCGGCGGCCCGGGCCTGG - Intronic
912386539 1:109273704-109273726 GCCCCTCGGAGGCCTCACCTGGG + Intronic
1065483564 10:26216519-26216541 GGTCCTCGGAGCCCGGACTCAGG - Exonic
1065801466 10:29356698-29356720 GCCCCTTGGGAGCCAGACCCAGG - Intergenic
1065902941 10:30224376-30224398 GCTCCCGGGAGGTCAGAGCCAGG - Intergenic
1067282031 10:44880243-44880265 GATCCTGGGAGGTCATACCCTGG + Intergenic
1068887889 10:62116149-62116171 GCTCATCAGAGGCCAGGCCTAGG + Intergenic
1069063921 10:63922868-63922890 GCTCCCCGGAGCCCTGACCCAGG - Intergenic
1069824766 10:71248195-71248217 GCTCCTCAGAGACAGGACCCAGG - Intronic
1070807341 10:79278313-79278335 GCTGCTCAGCAGCCAGACCCAGG - Intronic
1071178554 10:82956103-82956125 GCTCCTGGGAAGGCAGACCCTGG - Intronic
1074867339 10:117552560-117552582 GCTGCTCGGAGGCCTGGCCCGGG + Intergenic
1075401213 10:122163056-122163078 GGTCCTTGGAGGCTAGCCCCGGG + Intronic
1076348042 10:129794145-129794167 GCTCCTCTGCCGCCAGGCCCCGG - Intergenic
1076806856 10:132863102-132863124 GGACCTTGGAGCCCAGACCCAGG - Intronic
1077222180 11:1422606-1422628 GCTCCTCAGAGGCCCTGCCCTGG - Intronic
1077225238 11:1436659-1436681 GCTGCTGGGAAGCCTGACCCTGG + Intronic
1077321201 11:1942879-1942901 GCCCAGGGGAGGCCAGACCCAGG - Intergenic
1077437757 11:2550933-2550955 GCTGCTCCCAGGCCAGACTCTGG + Intronic
1077507867 11:2940464-2940486 CCTCCTCAGAACCCAGACCCTGG - Intergenic
1083428485 11:62601708-62601730 GCTCCTGCCAGGCCAGAGCCAGG + Exonic
1084091695 11:66883043-66883065 GCTCCTGGGGGCCCAGAGCCCGG - Intronic
1084112532 11:67023318-67023340 GCTCCTCGGAGGCGGGAGCCCGG + Intronic
1084196079 11:67524126-67524148 GGGCCCCGGAGGACAGACCCAGG - Intergenic
1084485134 11:69443676-69443698 GCTCCTCGCAGGGAAGACCCCGG + Intergenic
1084514373 11:69628289-69628311 GCGGCTCTGGGGCCAGACCCTGG - Intergenic
1084849662 11:71928708-71928730 GCTCCTTGGAGCCCAGACTGAGG + Exonic
1086322309 11:85664146-85664168 GGTTCTCGGCTGCCAGACCCCGG + Exonic
1087039481 11:93784663-93784685 CCTCCTCGGAGCCCGAACCCTGG - Exonic
1089073100 11:115716392-115716414 GGTCCTCTGGGGACAGACCCTGG + Intergenic
1089564409 11:119363461-119363483 ACTCCTCCGAGGCCAAACCCCGG - Intronic
1096208275 12:49741738-49741760 CCTGCTCGGAGACCAGACTCGGG + Intronic
1096373117 12:51084690-51084712 GCTCCTCGGGAGGCCGACCCAGG + Intergenic
1096984851 12:55749555-55749577 GCTCGTCGCAGTCCAGACCCAGG - Exonic
1098139772 12:67439633-67439655 GCTCCACGTGGGCCAGAACCAGG - Intergenic
1099228888 12:80000475-80000497 GCTCTTGGGAAGACAGACCCAGG + Intergenic
1101866516 12:108524488-108524510 ACTCCACGTAGGCCAGGCCCTGG + Exonic
1102508831 12:113400750-113400772 TCTCCTCAGAGGCCCCACCCTGG - Intronic
1103945399 12:124523352-124523374 GCTCCTGGGAACCCACACCCCGG + Intronic
1104569011 12:129909029-129909051 GATCCTCAGAGTGCAGACCCGGG + Intergenic
1104595964 12:130120139-130120161 TCCCCTCTGAGGCCAGACCTGGG - Intergenic
1104602191 12:130161812-130161834 CCTCCTCGGAGCCCGGAGCCCGG + Intergenic
1105067739 12:133215470-133215492 GCTCCCCAGAGGCCAGCTCCAGG + Intergenic
1105409583 13:20160853-20160875 GCGCCCCGGAGGCCAGGCACAGG - Intronic
1107718856 13:43227295-43227317 GCTCCTTGGGGTGCAGACCCAGG - Intronic
1108495643 13:51022210-51022232 GATCCTGGGAGGCCAGACAGAGG - Intergenic
1118457629 14:65959088-65959110 CATCCTCAGAGGCCAGACCAGGG - Intronic
1119442434 14:74637327-74637349 TCTCCAGAGAGGCCAGACCCTGG - Intergenic
1120941503 14:89954634-89954656 TCTTCTCCGAGGCCAGAGCCAGG - Exonic
1121610172 14:95273292-95273314 GCTCCACAGAGGCCAGGCCTGGG + Intronic
1122153614 14:99737723-99737745 GCTCCTCCGCGTCCAGCCCCAGG - Intronic
1122494057 14:102139667-102139689 GCCGCCCGGAGGCCACACCCGGG + Exonic
1122718061 14:103707111-103707133 GCTCCGCGGTGGCCTGCCCCTGG - Exonic
1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG + Intergenic
1123579416 15:21703159-21703181 GCATCTCAGAGGCCAGACACGGG + Intergenic
1123616043 15:22145670-22145692 GCATCTCAGAGGCCAGACACGGG + Intergenic
1128322187 15:66701748-66701770 GCTCCTCAGAGGCTCAACCCTGG + Intergenic
1130354800 15:83119375-83119397 CATCCTCTGTGGCCAGACCCTGG + Intronic
1130709186 15:86262949-86262971 GATCCTGGGAGGCCAAACCAGGG + Intronic
1130765152 15:86862607-86862629 GCTACTCGGAGGGCTGACGCAGG + Intronic
1202988286 15_KI270727v1_random:437404-437426 GCATCTCAGAGGCCAGACACGGG + Intergenic
1132603506 16:784154-784176 GCTCCTCCCTGGCCAGCCCCGGG - Intergenic
1132665968 16:1081523-1081545 GCTCCCCCGAGGCCCGACACAGG + Intergenic
1133054526 16:3138933-3138955 GCTGCTGGGAGGCCTGAGCCGGG + Intronic
1133058371 16:3158687-3158709 GCGCCTCGGGGACCAGCCCCGGG - Intergenic
1133304028 16:4798930-4798952 GGTCCTGGGAGGTCAGTCCCAGG + Intronic
1133886249 16:9830716-9830738 GCACATTGGAGGCCAAACCCAGG + Intronic
1134044497 16:11091363-11091385 GCGCCACTGGGGCCAGACCCGGG - Intronic
1134686094 16:16159662-16159684 TTTTCTGGGAGGCCAGACCCAGG + Intronic
1136109390 16:28055098-28055120 ACCCCTCAGAGGCCAGAGCCAGG - Intronic
1137300708 16:47144683-47144705 GCTGCTAGGAGGGCAGCCCCGGG - Intergenic
1137619419 16:49866729-49866751 GCCCCTGGGAAGCCAGGCCCTGG - Intergenic
1141380754 16:83574514-83574536 GCTGCTCTGAGATCAGACCCAGG + Intronic
1141658783 16:85430530-85430552 GCACCTCGAAGGCCAGGCCAGGG + Intergenic
1141664718 16:85460062-85460084 GCTCATCGGAGGCCAGGCGCTGG - Intergenic
1142348776 16:89570514-89570536 GCTGCTGGGAGGCCTGACACTGG - Intergenic
1142967083 17:3588387-3588409 GCCCGTCAGAGGCCAGCCCCAGG + Intronic
1143510556 17:7393284-7393306 TCTCCTCGGCCGCCTGACCCAGG + Exonic
1144128679 17:12225217-12225239 CCTCCTAGAAGGCCAGGCCCAGG - Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1147685357 17:42283817-42283839 CCACCTCTGAGGCCAGGCCCTGG - Intergenic
1148821049 17:50359904-50359926 ACTCCGTGGAGGCCAGACCCAGG - Intronic
1150294743 17:64001752-64001774 CCTCCTATGAGGACAGACCCCGG + Exonic
1151236042 17:72720390-72720412 GCTACTCGGAGCCCAGGTCCAGG - Intronic
1151718551 17:75843585-75843607 GCTCCTCTGAGGCCTGATCCAGG + Intronic
1151974263 17:77475581-77475603 GCTCCCCTGAATCCAGACCCTGG - Intronic
1151976386 17:77485758-77485780 GCTCCTGGGAGGACAGAGGCTGG - Intronic
1152364031 17:79844866-79844888 GCTCCTCGCCTGCCAGTCCCGGG + Intergenic
1152471453 17:80492148-80492170 GCTCCTGGGAACCCAGACACAGG + Intergenic
1152610200 17:81311610-81311632 CCTCCTCTGAGGCCAGGCCTGGG + Exonic
1152610418 17:81312604-81312626 GCCCCTCTGATGCCAGGCCCTGG + Exonic
1152848112 17:82614975-82614997 GGGGCTCGGAGGCCAGACCAGGG + Exonic
1154059096 18:11042214-11042236 ACTTCTCAGAGGACAGACCCTGG + Intronic
1160134748 18:76262659-76262681 GCTCCTCGCAGGGCAGCCCTGGG + Intergenic
1160679819 19:407537-407559 GCACCCCGGACGCCAGCCCCGGG - Exonic
1160732818 19:649005-649027 GCTCCTCGGGGGCCCGGCCCGGG + Intronic
1161344223 19:3759979-3760001 TCTCCTGGGAGGCCAGGCCATGG + Exonic
1161663543 19:5561381-5561403 CCACCTGGGAGCCCAGACCCTGG + Intergenic
1162910694 19:13846705-13846727 GCTCCTCCCAGCCCAGCCCCCGG + Intergenic
1163590976 19:18193938-18193960 AAGCCTCGGAGGCCAGACGCAGG - Exonic
1164806888 19:31123857-31123879 GCTCCTTGCAGGCCAGAACTTGG + Intergenic
1164990054 19:32676455-32676477 GCTCGTCGGCGGCCAGGCCCCGG - Exonic
1165449073 19:35871869-35871891 GCTCCCCGGGGGCCAGGACCGGG - Exonic
1167179509 19:47891856-47891878 GCTCCTCAGAGGCCTCACTCTGG - Intergenic
1167423145 19:49415428-49415450 GCTCCTCAGAGCCCAGTGCCCGG + Intronic
1167674610 19:50876679-50876701 GCTCCTGGGTGGGCAGGCCCAGG - Exonic
927103708 2:19807022-19807044 GAGCCTCGGAGGACAGATCCAGG + Intergenic
927248886 2:20980743-20980765 GTCCCACAGAGGCCAGACCCAGG - Intergenic
928300588 2:30120955-30120977 GCTTCTCTGTGGCCAGACCTGGG - Intergenic
929775740 2:44929592-44929614 CCTGCTCGGAGGCGAGGCCCGGG - Intergenic
931470814 2:62536206-62536228 GCTCCTCGGCTGCAAGATCCGGG + Intergenic
932310232 2:70733997-70734019 GCACTGCTGAGGCCAGACCCAGG - Intronic
932491745 2:72127164-72127186 TCTCCTGGGAGGCCAGACGTGGG + Intergenic
933747296 2:85580442-85580464 GCCCTTGGGAGGGCAGACCCTGG - Intronic
933782168 2:85810550-85810572 ACTCCTCGGGTGCCAGGCCCAGG + Intergenic
936076385 2:109404385-109404407 GCTACTCAGAGGCCAGGCGCTGG - Intronic
938555427 2:132419024-132419046 GCTGGTCTGAGGCAAGACCCAGG - Intronic
940247760 2:151637601-151637623 GCTACTCGGCTGCCAGTCCCAGG - Intronic
942360733 2:175168632-175168654 GGTCCTCCGAGCCCAGCCCCAGG + Intergenic
942681456 2:178480984-178481006 GGTCCGCGGAGGCCAGACGGAGG - Intronic
945530734 2:210950600-210950622 GCTCCTCGCATCCCAGACCATGG - Intergenic
946231061 2:218291649-218291671 GCTGCTGGGAGGCCAGGCCCTGG - Intronic
947674117 2:231961829-231961851 GCCCCCCAGAGGCCAGACCCCGG - Intronic
947871333 2:233440539-233440561 GCTCCTCGGATGCCAGCTCGGGG - Intronic
948466683 2:238155576-238155598 GCTGCTGGGAAGCCAGGCCCGGG + Intergenic
948802491 2:240439235-240439257 GCTTCTCGGAGGACACCCCCAGG + Intronic
949019664 2:241734259-241734281 GCTCCTCCGAGGCCGAGCCCAGG - Intergenic
1170044510 20:12071313-12071335 ACTCTTCGGAGGCCAGCCCATGG + Intergenic
1171196641 20:23205082-23205104 CCTCCTAGGAATCCAGACCCGGG + Intergenic
1172104147 20:32506204-32506226 CCTCCTTGGAAGCCAGGCCCAGG - Intronic
1172208011 20:33178240-33178262 ACTCCTTGGAGCCCAGATCCAGG + Intronic
1172799575 20:37566508-37566530 TCTTCTAGGTGGCCAGACCCAGG + Intergenic
1172800780 20:37574649-37574671 GCTACTTGGAGGGCAGACTCCGG + Intergenic
1173021006 20:39268367-39268389 GCTCCAAGGAGGCCAGGCCGTGG + Intergenic
1175751656 20:61502396-61502418 CCTCATCAGAGGCCAGTCCCAGG - Intronic
1175820704 20:61907342-61907364 GATCCTGGGCGGCCAGGCCCCGG - Intronic
1175971552 20:62689160-62689182 GCGCCTCGTAGGCCTGTCCCTGG + Intergenic
1175971579 20:62689260-62689282 GTTCCTCGCAGGCCTGTCCCCGG + Intergenic
1176190579 20:63807855-63807877 CGGCCTCGGAGGCCAGACACCGG - Intronic
1176277397 20:64280115-64280137 GCTCCCCAGAGGCCAGCTCCAGG - Intronic
1176284994 21:5014695-5014717 GCTTCTCGGGGTCCAGCCCCTGG + Intergenic
1176337854 21:5615612-5615634 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176339262 21:5678685-5678707 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176471516 21:7110838-7110860 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176495077 21:7492616-7492638 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176505565 21:7645771-7645793 GCTCCCCATAGGCAAGACCCAGG + Intergenic
1178827395 21:36028333-36028355 GCTCCTCTGTGGGCAGAGCCAGG + Intergenic
1179435206 21:41357989-41358011 GCTCTTCTGGGGCCAGGCCCGGG - Intergenic
1179872187 21:44248780-44248802 GCTTCTCGGGGTCCAGCCCCTGG - Intronic
1179882632 21:44299968-44299990 CCTCCTCGCAGGACGGACCCTGG - Intergenic
1179984160 21:44911929-44911951 GGTCCTGGGAGGTCAGACCCAGG - Intronic
1180750908 22:18123684-18123706 GCTACTCGGAGGCCTGAGGCAGG - Intronic
1180980769 22:19877039-19877061 GCTCCTCGGAGGCCAGACCCAGG - Exonic
1182071220 22:27465086-27465108 GCTCCTGGGAGGCCAAGCTCAGG + Intergenic
1182555179 22:31125297-31125319 GCTCCTCAGAAGCCAGGGCCAGG - Exonic
1183217746 22:36492112-36492134 GCCCCTGGGAGGCCAGGCCATGG + Intronic
1183457089 22:37928793-37928815 GCTCTACTGATGCCAGACCCTGG + Intronic
1183879969 22:40819130-40819152 GCTTCTCGGGGGCCAGTCCCGGG - Intronic
1183951829 22:41356811-41356833 GCTCCTGGGAGGGCAGGGCCTGG + Intronic
1184877467 22:47284572-47284594 GCTCCTCTGTGGCCAGCCCAGGG + Intergenic
950777312 3:15361932-15361954 GCTCCTCTGAGCCCACACACAGG + Intergenic
951505468 3:23440160-23440182 GCTACTCGGAGGGCTGACGCAGG + Intronic
953881572 3:46693799-46693821 GCTCCTCGGTGGCCCGCCCGTGG - Intergenic
954141500 3:48609182-48609204 ACTGCTCGGAGGCCACACGCAGG + Exonic
954453164 3:50582623-50582645 CTTCCTCGGAGGGCAGACACAGG + Exonic
954453701 3:50585606-50585628 GCTACTGGGAGGCCAGACATGGG + Intergenic
960989516 3:123301551-123301573 ACTCCTCACAGACCAGACCCTGG - Intronic
961330141 3:126133668-126133690 GCTCCCCAGAGCCCAGTCCCTGG + Intronic
961552581 3:127677621-127677643 GCTCCTCAGGAGACAGACCCTGG + Intronic
961737580 3:129011756-129011778 ACTTCTCGGAGGACAGAGCCTGG + Intronic
966474341 3:180326143-180326165 GCTTCTGAGAAGCCAGACCCTGG + Intergenic
966787953 3:183636936-183636958 GGTCCTCGGAGGGCAGGCCACGG - Intronic
968441160 4:625206-625228 CCTCCTGGGAGCCCAGACCTGGG - Intergenic
968747300 4:2366753-2366775 GCTCCCCAGAAGCCGGACCCTGG + Intronic
968923146 4:3532898-3532920 GCTCCGCGGAGGGCAGAAGCGGG - Intergenic
968968134 4:3779705-3779727 GCTCCCCGGAGGGCAGGTCCAGG + Intergenic
969631914 4:8343862-8343884 GCTGCTGGGAGCCCAGCCCCTGG + Intergenic
975640619 4:76496357-76496379 GCTCCACGAAGGCCTGACACAGG - Intronic
985905636 5:2833722-2833744 GCTCCGGGCAGGTCAGACCCCGG + Intergenic
987303394 5:16616908-16616930 GCTCCTCGGCGGCAGGAGCCGGG + Exonic
992364965 5:76082313-76082335 GCTCCCGTGAGGCCACACCCAGG - Intergenic
993899911 5:93578476-93578498 GCTCCCGGGAGCCCAGGCCCCGG + Intergenic
998103166 5:139451042-139451064 GCTCCTCTGAGGCCAGGGCTGGG - Intronic
998809953 5:145956385-145956407 GCTACTCGGAGGCCTGAGGCAGG - Intronic
1001653461 5:173330780-173330802 GGTCCTCTGAGGGCAGCCCCAGG - Intergenic
1002134769 5:177100795-177100817 GCACATTGGAGACCAGACCCAGG + Intergenic
1002505977 5:179679376-179679398 GCTCCTCGGTGGCCAGCAGCTGG - Intronic
1002710394 5:181191598-181191620 CTTCCTGGGAGGCCAGAGCCTGG - Intergenic
1012100948 6:95084769-95084791 CCTCCTGGGAGCCCAGACCTTGG + Intergenic
1014572287 6:123024590-123024612 TCTCTTCAGAGGCCATACCCTGG + Intronic
1015799220 6:137044266-137044288 GCCCCTCGCCGGCCAGTCCCAGG - Intronic
1019528861 7:1493883-1493905 GCACCTCGGAGCACAGACGCAGG + Exonic
1019597353 7:1864311-1864333 GCTCCCTGCAGGGCAGACCCGGG + Intronic
1024263750 7:47590889-47590911 GCTACTCGGAAGCCAGAGGCAGG + Intergenic
1024323304 7:48089815-48089837 GCTTCTCGCAGCCCAAACCCGGG + Intronic
1025179008 7:56815697-56815719 GCCCCTGGGAGGCAAGAGCCGGG + Intergenic
1026458942 7:70596382-70596404 CCACCTCGGAAGCCAGACCCGGG + Intronic
1026817016 7:73521552-73521574 GCTCCTCGCCGGCGAGGCCCCGG + Intronic
1026926580 7:74198272-74198294 GCTTCTCTGAAGTCAGACCCTGG + Intergenic
1029324540 7:99794749-99794771 GCTCAGAGGAGACCAGACCCTGG + Intergenic
1029456265 7:100674001-100674023 GCTCCCAGGAGGCCAGCCCCGGG - Intronic
1029872414 7:103708819-103708841 GCCCCTCAGAGGCCTTACCCTGG + Intronic
1031804617 7:126292851-126292873 CCTCCTGGGGGGTCAGACCCAGG - Intergenic
1031977360 7:128102547-128102569 GCTCCTGGGAGGTCTGACCAAGG + Intergenic
1034377849 7:150662169-150662191 GCTCCTTGTGGGCCAGTCCCTGG + Intergenic
1035064658 7:156095902-156095924 CCTGCTCTGAGGACAGACCCAGG - Intergenic
1038004225 8:23416447-23416469 CCTCCTGTGAGCCCAGACCCAGG + Intronic
1038517893 8:28202727-28202749 TCTGCTCTGAGCCCAGACCCTGG - Intergenic
1038668474 8:29562338-29562360 GTTCCTAGGAGCCCAGCCCCGGG - Intergenic
1039604059 8:38866468-38866490 GTTCCTAAGAGGCCAGTCCCTGG + Intergenic
1039899869 8:41743907-41743929 GCTCATCGGGGGCTGGACCCTGG + Intronic
1048335426 8:133498819-133498841 CCTCCTGGGAGAACAGACCCAGG + Intronic
1049345176 8:142134895-142134917 GCTCCTCAGAGGCCCGGCCTCGG - Intergenic
1049496758 8:142939237-142939259 CCTCCTGGGAGGCCAGGCCCTGG - Intergenic
1049610686 8:143553451-143553473 GGTCCTGGGGGGCCAGAGCCTGG - Exonic
1049782736 8:144436234-144436256 GCTCCTCCGAGGCCTGGCCATGG + Exonic
1053268988 9:36737093-36737115 TCTACTCTGAGGCCAGACCCTGG + Intergenic
1054353181 9:64037649-64037671 GCTCCTCGGGAGCCAGAGGCAGG + Intergenic
1059425807 9:114220309-114220331 GCTCCTCGGGGAACAGAGCCTGG - Intronic
1059632159 9:116136315-116136337 AATCCTTGGAGGCCAGCCCCTGG - Intergenic
1060934923 9:127509207-127509229 GGTCCTCGAAGTCCAGGCCCTGG + Intronic
1061264623 9:129497802-129497824 CCTCTGCGGAGGCCAGGCCCAGG - Intergenic
1061304786 9:129725899-129725921 GGGCCTGGGAGGCCAGTCCCAGG + Intergenic
1061722337 9:132560281-132560303 CCTCGTCTGAGGCCAGACCTTGG - Intronic
1062103624 9:134740920-134740942 ACTCCACGGATGGCAGACCCTGG - Intronic
1062208113 9:135348368-135348390 TCTCCCGGGAGGCCTGACCCAGG + Intergenic
1062491900 9:136808694-136808716 GCTCCACGGTGCCCAGCCCCGGG + Intronic
1202795311 9_KI270719v1_random:115238-115260 GCTCCTCGCAGGCCTGACAAAGG + Intergenic
1203423815 Un_GL000195v1:19304-19326 GCTCCCTGTAGGCAAGACCCAGG + Intergenic
1203741517 Un_GL000218v1:6755-6777 GCTCCTCGGAAGCCAGAGGCAGG + Intergenic
1185643483 X:1600961-1600983 CCCCCTCGGGGGCCAGCCCCCGG + Exonic
1186500376 X:10045948-10045970 GCCCCTCGGAGGACACACACTGG - Intronic
1190116105 X:47627171-47627193 GCTGCTCGTAGGCTAGCCCCGGG + Exonic
1190760426 X:53433829-53433851 GCTCCGCCGTGGCCAGGCCCAGG + Exonic
1191927470 X:66329147-66329169 GGTGCTCGGGGGCCAGCCCCAGG + Intergenic
1198363515 X:135918359-135918381 GCTGCTCCGTGCCCAGACCCAGG - Intergenic
1201155046 Y:11124208-11124230 GCTCCTCGGAAGCCAGAGGCAGG + Intergenic