ID: 1180980968

View in Genome Browser
Species Human (GRCh38)
Location 22:19877796-19877818
Sequence GCTCATGGTGGCGTGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180980962_1180980968 8 Left 1180980962 22:19877765-19877787 CCTGGGGTGGCTCTCCAGGTACT No data
Right 1180980968 22:19877796-19877818 GCTCATGGTGGCGTGGTGCTTGG No data
1180980964_1180980968 -6 Left 1180980964 22:19877779-19877801 CCAGGTACTGGCACTCTGCTCAT No data
Right 1180980968 22:19877796-19877818 GCTCATGGTGGCGTGGTGCTTGG No data
1180980955_1180980968 27 Left 1180980955 22:19877746-19877768 CCAGAAGACACACAGCAGCCCTG No data
Right 1180980968 22:19877796-19877818 GCTCATGGTGGCGTGGTGCTTGG No data
1180980961_1180980968 9 Left 1180980961 22:19877764-19877786 CCCTGGGGTGGCTCTCCAGGTAC No data
Right 1180980968 22:19877796-19877818 GCTCATGGTGGCGTGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180980968 Original CRISPR GCTCATGGTGGCGTGGTGCT TGG Intronic