ID: 1180985058

View in Genome Browser
Species Human (GRCh38)
Location 22:19899190-19899212
Sequence CTGTTCAAACAGCTTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180985055_1180985058 6 Left 1180985055 22:19899161-19899183 CCTTGGTCAGCTCGTGGGCTCCA 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1180985046_1180985058 26 Left 1180985046 22:19899141-19899163 CCCGCAGCCTTTGCCCAGGCCCT 0: 1
1: 0
2: 8
3: 60
4: 514
Right 1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1180985050_1180985058 13 Left 1180985050 22:19899154-19899176 CCCAGGCCCTTGGTCAGCTCGTG 0: 1
1: 0
2: 1
3: 6
4: 129
Right 1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1180985045_1180985058 27 Left 1180985045 22:19899140-19899162 CCCCGCAGCCTTTGCCCAGGCCC 0: 1
1: 0
2: 6
3: 42
4: 441
Right 1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1180985054_1180985058 7 Left 1180985054 22:19899160-19899182 CCCTTGGTCAGCTCGTGGGCTCC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1180985051_1180985058 12 Left 1180985051 22:19899155-19899177 CCAGGCCCTTGGTCAGCTCGTGG 0: 1
1: 0
2: 2
3: 12
4: 180
Right 1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1180985049_1180985058 19 Left 1180985049 22:19899148-19899170 CCTTTGCCCAGGCCCTTGGTCAG 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1180985047_1180985058 25 Left 1180985047 22:19899142-19899164 CCGCAGCCTTTGCCCAGGCCCTT 0: 1
1: 0
2: 9
3: 85
4: 591
Right 1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180985058 Original CRISPR CTGTTCAAACAGCTTGCCCC AGG Intronic
903185307 1:21625475-21625497 CTGGTCAGACAGCTTGCATCCGG + Intronic
903690449 1:25169515-25169537 CTTTTCCAACAGCTGGTCCCTGG - Intergenic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
906666130 1:47623353-47623375 CTGTTCCACCACCTTGGCCCCGG - Intergenic
907188858 1:52632644-52632666 CTGTTCATACTGCCTGCCACTGG - Intergenic
907427769 1:54391729-54391751 CTGTGCAAACAGCTGTCACCAGG + Intronic
909337427 1:74491964-74491986 CTATTCACTCAGCTTGCTCCTGG - Intronic
913348609 1:117832671-117832693 CTGTTCAAGCACCTTGTACCTGG + Intergenic
914391335 1:147225741-147225763 CTGTTCAAACAGATTGTAGCAGG + Intronic
920937678 1:210450701-210450723 ATGTACAAACAGCTTTCCCCTGG + Intronic
921097042 1:211895554-211895576 GTGTTCAAACACCTTAGCCCTGG - Intergenic
1067771618 10:49130736-49130758 CTGATCAAACAGCTTGAACTTGG + Intergenic
1069686534 10:70322594-70322616 GTCCTCAAACAGCTTGCACCTGG - Intronic
1070819249 10:79345481-79345503 CAGTTCCAACAGCCTGCCCTTGG + Intergenic
1071152863 10:82656055-82656077 CTGTTAAAACTGTTTGCCTCTGG + Intronic
1071960098 10:90801788-90801810 CTGTTCAATCAGATTGCACAAGG - Intronic
1075671986 10:124269152-124269174 CTGTTACAAAAGCTTCCCCCAGG + Intergenic
1077629024 11:3798107-3798129 CTGTCCAAAGAGTTTGCCCGAGG + Intronic
1078451520 11:11444095-11444117 CTGTTAAAACAACTCTCCCCAGG + Intronic
1083110014 11:60397106-60397128 CTGTGCATACAGCTCTCCCCTGG - Intronic
1086462585 11:87020084-87020106 CTGTTTAAACAGCTTCTCACAGG - Intergenic
1088110265 11:106252535-106252557 CTATTCAAACTGCTGGCCTCAGG + Intergenic
1089641793 11:119852714-119852736 CTGATTAAACAGCTAGCCCAAGG - Intergenic
1090308619 11:125714439-125714461 CTTTTCAAAAAGCCTGCTCCTGG + Intergenic
1091246138 11:134096544-134096566 CTGCCCAAACAACTGGCCCCTGG - Intronic
1091993758 12:4977008-4977030 CTGTTCTGGGAGCTTGCCCCTGG - Intergenic
1094469985 12:30794754-30794776 TTGTGCAAAGAGCTTGCCACAGG + Intergenic
1095819330 12:46460179-46460201 CTCTTCAAACACTTTGTCCCTGG + Intergenic
1098466198 12:70789042-70789064 CTGTTGAAACAGCAAGCACCTGG - Intronic
1104772039 12:131369543-131369565 CTGTTCTAACAACATGCCCCAGG + Intergenic
1105531374 13:21223759-21223781 CTGGTTAAACATCTTGCCCAAGG - Intergenic
1107408111 13:40134132-40134154 CTGTTTGTACAGCTTGCCCCTGG + Intergenic
1109953049 13:69527624-69527646 CTGTTGAAACAGCTGGACACAGG + Intergenic
1112863943 13:103870665-103870687 ATGTTCAAACTGCTTTCCACAGG + Intergenic
1114964973 14:27946376-27946398 CTGTTTCAACAGCTTGGTCCTGG - Intergenic
1115080082 14:29440062-29440084 AAGTTTAAACAGCTTGCCCAGGG + Intergenic
1120755592 14:88241302-88241324 AGGTTCAAACAACTTGCCCAAGG - Intronic
1121578633 14:95009629-95009651 CTCTGCAAACTGCTGGCCCCTGG - Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1128080782 15:64855609-64855631 CTGTACACACAGCATGTCCCAGG - Intronic
1128792829 15:70445556-70445578 CTGTTCCCCCTGCTTGCCCCTGG + Intergenic
1131168231 15:90158259-90158281 CTGTGCAAGCAGCTTTGCCCAGG + Intergenic
1133559019 16:6932617-6932639 CTGCCCAAACATCTAGCCCCAGG + Intronic
1133961950 16:10502462-10502484 CTGTTAAAACAGCATGCACTAGG + Intergenic
1136067835 16:27770709-27770731 GTGTTCACACAGCTGGCCCTCGG - Intronic
1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG + Intergenic
1138534858 16:57654357-57654379 CTGTTCACACGGGTGGCCCCAGG - Intronic
1139339519 16:66258995-66259017 AAGGTCAAGCAGCTTGCCCCAGG + Intergenic
1139706772 16:68746495-68746517 CTCATCAAACATCTAGCCCCTGG - Intronic
1142987952 17:3708408-3708430 CAGTTCAAACAACATGACCCTGG - Intergenic
1143783339 17:9240595-9240617 CTGTCCAGCCAGCATGCCCCAGG + Exonic
1143877205 17:10001059-10001081 ACGTTCACACAGCTTGGCCCTGG + Intronic
1149609134 17:57946921-57946943 CTGTTCACACACCTTGCCATTGG + Intronic
1150436456 17:65157878-65157900 CCCTGCAAACAGCTTGCCTCGGG + Intronic
1155968156 18:32055351-32055373 CTGTTCCAACATCTTGCTCCCGG + Intronic
1155976317 18:32135451-32135473 CTTTTCAAACTTCTTGCCTCAGG + Intronic
1157901605 18:51523414-51523436 AGGTTCAGACAGCTTGCCACTGG - Intergenic
1158619757 18:59022801-59022823 CCGTGCAAACAGCTTCCACCTGG - Intergenic
1161561921 19:4978143-4978165 CTATTCCAACTGCTTCCCCCAGG + Intronic
1161922829 19:7279394-7279416 CTGTTCACACAAACTGCCCCTGG - Intronic
1162781566 19:13009642-13009664 GTGTTCAAACTGTCTGCCCCTGG + Intronic
1164590383 19:29503634-29503656 CTGTTCGAACAGCTGACCCCAGG - Intergenic
1164721788 19:30437915-30437937 CAGTGAGAACAGCTTGCCCCTGG - Intronic
1164811988 19:31164724-31164746 CTGTTCCAGCAGCTCTCCCCGGG + Intergenic
1165008204 19:32823620-32823642 CTCTTCATAAAGTTTGCCCCTGG + Intronic
925181202 2:1817964-1817986 CTGCTCCACCCGCTTGCCCCAGG + Intronic
927110619 2:19861491-19861513 CTGACCAGACAGGTTGCCCCTGG - Intergenic
928888190 2:36174141-36174163 CTGTTCAAAGAGCATTGCCCAGG - Intergenic
930665951 2:54098527-54098549 CTGTTCAAAGAAGTTGCCTCGGG - Intronic
931570553 2:63664874-63664896 GTGATCAAACACATTGCCCCAGG + Intronic
932981666 2:76676167-76676189 CTGTCCAAACTGTTGGCCCCAGG - Intergenic
933208597 2:79538796-79538818 CTAATTAGACAGCTTGCCCCTGG - Intronic
933488238 2:82950165-82950187 CTGTGCCCACAGCTTCCCCCAGG + Intergenic
934937205 2:98473995-98474017 CTGGGCAAACTGCTTGCCTCTGG - Intronic
935846869 2:107175450-107175472 CTGTTCAAACACCTTGCAGGAGG - Intergenic
939291332 2:140199171-140199193 CAGACCAAACAGCTTGCCCGTGG - Intergenic
940109663 2:150137544-150137566 GTCTGCAAACATCTTGCCCCAGG + Intergenic
942503307 2:176615057-176615079 CAGTTAAAATAGTTTGCCCCAGG + Intergenic
948791094 2:240377173-240377195 CTGGGTGAACAGCTTGCCCCGGG - Intergenic
1172438618 20:34949097-34949119 CTGTTAACAATGCTTGCCCCTGG + Intronic
1173858218 20:46264964-46264986 GGGTTCTAACAGGTTGCCCCTGG - Intronic
1174050902 20:47766745-47766767 CTGTTCTCACAGCTTGCCGGTGG - Intronic
1177613117 21:23479789-23479811 CTGTTCACTCAGATTTCCCCAGG - Intergenic
1178947505 21:36960180-36960202 CTCTGCACCCAGCTTGCCCCTGG + Intronic
1180132436 21:45835251-45835273 CTGTTTAAACTTCATGCCCCGGG + Intronic
1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG + Intronic
1182869997 22:33637607-33637629 CTGTTTAAACTGCTTACCCTGGG + Intronic
1184311198 22:43644208-43644230 CTGCTCAAAGAGCTTGCCTAGGG - Intronic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
954475407 3:50739759-50739781 TTGTTCAATTAGCCTGCCCCAGG - Intronic
956711628 3:72043304-72043326 AAGATCAAACAGCTTGCCTCAGG + Intergenic
960108790 3:113825602-113825624 CTTTTCAAACAGCTTTGACCTGG + Intergenic
961512073 3:127409292-127409314 CTGTTCAGACAACCTGTCCCAGG + Intergenic
967304592 3:188048302-188048324 CTGTTCAAACAGAATTCTCCAGG - Intergenic
968888748 4:3354169-3354191 CTGCCCAGCCAGCTTGCCCCAGG + Intronic
971722374 4:30262210-30262232 CTGTTCAAATAGCATGCTCTAGG + Intergenic
973653774 4:53024327-53024349 CTTTTCATCCAGCTTGTCCCAGG + Intronic
973741119 4:53920346-53920368 CTGTCCTCACTGCTTGCCCCAGG + Intronic
974350215 4:60734693-60734715 CTTTTCAAAAAGCTAGCTCCTGG + Intergenic
974356796 4:60823173-60823195 CTCTTGAACTAGCTTGCCCCTGG + Intergenic
975236158 4:71999254-71999276 CTTTTCAAACAACCTGCTCCTGG - Intergenic
975868310 4:78749354-78749376 CTGTTGAAATAGGTTGCCTCGGG + Intergenic
977681110 4:99799397-99799419 CTGACCAAACAGCTTGCTCAAGG + Intergenic
980271808 4:130593694-130593716 TTATTCAGACAGCTTCCCCCAGG + Intergenic
980826979 4:138085556-138085578 ATGTTGAAACAGTTTTCCCCAGG + Intergenic
984915445 4:184719089-184719111 CTGTTCAGCCATCTTGCTCCTGG - Intronic
991597023 5:68316237-68316259 CTGTTCAAAGAAATTGCCTCAGG + Intergenic
992407324 5:76472145-76472167 CTTTCCAACCAGCTTGCCTCAGG + Intronic
998391929 5:141792751-141792773 CTGGTCAAACAACTTGACCCAGG + Intergenic
999274269 5:150318655-150318677 CTCTTCAGAGAGGTTGCCCCTGG - Intronic
999733837 5:154497808-154497830 CTGGACAAGCAGCTTGTCCCTGG + Intergenic
1001204487 5:169749590-169749612 CAGTTGAAACAGCTTCCTCCAGG + Intronic
1002877988 6:1227953-1227975 CTTTCCAAACAGCATGCACCTGG + Intergenic
1005716935 6:28558330-28558352 CTTTTCAAACATTTTTCCCCTGG - Intergenic
1008782687 6:55126674-55126696 CTGCTGAAACCCCTTGCCCCAGG + Intronic
1010707800 6:79135265-79135287 CAGGGCTAACAGCTTGCCCCAGG + Intergenic
1011111131 6:83837648-83837670 GTGTTAAAACAGTTTCCCCCAGG + Intergenic
1012971968 6:105740915-105740937 CATTTCAAACATCTTGCCTCAGG - Intergenic
1014752678 6:125271829-125271851 CTGTTACATCAGTTTGCCCCTGG - Intronic
1014836230 6:126163909-126163931 CTTTTCAAAAAGCCTGCTCCTGG + Intergenic
1015596389 6:134871529-134871551 CTGTACATACAGCTTGCACCTGG - Intergenic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1020330077 7:7008732-7008754 CTTTTCAAAAAACTTGCTCCTGG + Intergenic
1021020225 7:15588416-15588438 TTGTTCACAGAGCTTGCCTCCGG - Intergenic
1023246533 7:38210912-38210934 CTTATTAAACAGCTTGCCCAAGG - Intronic
1023686880 7:42745224-42745246 CTGTTCAAACTGTTCGCCACCGG + Intergenic
1024512461 7:50214475-50214497 CTGGTCAACCAGCTGCCCCCAGG + Intergenic
1025720747 7:64010178-64010200 CTGTTCAAAAAGCCAGCTCCTGG + Intergenic
1026948911 7:74334347-74334369 CTGTTGAAACAACTGGTCCCTGG + Intronic
1030009392 7:105151316-105151338 CAGCTTAAACAGCTTGCCCAGGG - Intronic
1034752523 7:153584132-153584154 CTGTTGCAACAGCTTGTCTCTGG + Intergenic
1037317732 8:17614843-17614865 CAGTTCAAACAACTTTCCCAGGG - Intronic
1037406131 8:18544769-18544791 CTGTTCCCACACCTCGCCCCAGG + Intronic
1037729679 8:21513948-21513970 CTGTTCTTACAGCTTTCCCTGGG - Intergenic
1040536912 8:48318628-48318650 CTGCTCAAATAGCTTTGCCCGGG - Intergenic
1044750469 8:95411035-95411057 CTGATCAAGCCACTTGCCCCAGG - Intergenic
1061754349 9:132802370-132802392 CTGTTCACAGAGCTTGTCACTGG - Intronic
1186469098 X:9807371-9807393 CTGTGCAACCTGCTTGCTCCTGG - Intronic
1186692968 X:11998855-11998877 CTTTCCAAACAGCTTGCATCAGG + Intergenic
1187166594 X:16809922-16809944 CTGTTCAAACATCCTTCTCCTGG - Intronic
1191104311 X:56763181-56763203 CTTTTTAAGCAGCTTGACCCAGG - Intergenic
1191104901 X:56766757-56766779 CTTTTTAAGCAGCTTGACCCAGG - Intergenic
1191108487 X:56787594-56787616 CTTTTTAAGCAGCTTGACCCAGG - Intergenic
1192436585 X:71147177-71147199 CTGTTCAAGCAGCATGCCCAGGG + Intronic
1200620632 Y:5441784-5441806 CTGTCCATACAGCATGCACCTGG + Intronic
1201475982 Y:14380947-14380969 CTGTTTATAGAACTTGCCCCAGG + Intergenic