ID: 1180987723

View in Genome Browser
Species Human (GRCh38)
Location 22:19915239-19915261
Sequence GATCACATCATCATTGCTAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180987723_1180987727 19 Left 1180987723 22:19915239-19915261 CCAGTAGCAATGATGATGTGATC 0: 1
1: 0
2: 1
3: 12
4: 85
Right 1180987727 22:19915281-19915303 GGAGAAAAAGAGAAAGCCGTGGG 0: 1
1: 0
2: 4
3: 50
4: 527
1180987723_1180987726 18 Left 1180987723 22:19915239-19915261 CCAGTAGCAATGATGATGTGATC 0: 1
1: 0
2: 1
3: 12
4: 85
Right 1180987726 22:19915280-19915302 AGGAGAAAAAGAGAAAGCCGTGG 0: 1
1: 0
2: 9
3: 109
4: 968
1180987723_1180987728 28 Left 1180987723 22:19915239-19915261 CCAGTAGCAATGATGATGTGATC 0: 1
1: 0
2: 1
3: 12
4: 85
Right 1180987728 22:19915290-19915312 GAGAAAGCCGTGGGTCAGACAGG 0: 1
1: 0
2: 2
3: 17
4: 269
1180987723_1180987725 -2 Left 1180987723 22:19915239-19915261 CCAGTAGCAATGATGATGTGATC 0: 1
1: 0
2: 1
3: 12
4: 85
Right 1180987725 22:19915260-19915282 TCGGCTGACAGCAGAATCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180987723 Original CRISPR GATCACATCATCATTGCTAC TGG (reversed) Exonic
904804231 1:33119720-33119742 GATTACATCATCAATGCAACGGG + Intronic
917951303 1:180039552-180039574 GATCACTTAATCATTGATAAAGG - Intronic
919544247 1:198893971-198893993 GACCACATCAGCATTACCACTGG - Intergenic
919647922 1:200114579-200114601 GATAACATCATAGTTGCCACTGG - Intronic
921979289 1:221237527-221237549 GATGTCATCATCATTGTTAACGG + Intergenic
924353416 1:243142940-243142962 GATCACATTACAGTTGCTACGGG + Intronic
1065491996 10:26291523-26291545 GATCACATCATCTCAGCTAAGGG - Intronic
1070436252 10:76396895-76396917 AATCACATTCTCATTGCTGCAGG + Intronic
1073344738 10:102774422-102774444 GATCACAGCTTCATTGCTAGAGG - Intronic
1076933714 10:133553212-133553234 CATCTCATCACCATTGCTATTGG + Intronic
1080356214 11:31449627-31449649 AATAACATCATCATTATTACTGG - Intronic
1083977344 11:66134070-66134092 GATCACATTGTCATTGTTCCAGG + Intronic
1086570374 11:88276868-88276890 AATCATATCATCATTGACACAGG - Intergenic
1090232235 11:125115949-125115971 GATTACATTAGCATTTCTACAGG + Intergenic
1093102376 12:15042710-15042732 ACTCACATGATCATTGCTAGTGG - Intergenic
1093588159 12:20867828-20867850 AAACACATCATAATTTCTACAGG - Intronic
1093818685 12:23584073-23584095 GAGCACATCAGCATCTCTACTGG + Intronic
1094177133 12:27552725-27552747 GAACAAAGGATCATTGCTACAGG + Intronic
1095502923 12:42860266-42860288 CATCACATCATCAGCCCTACTGG + Intergenic
1106972856 13:35164447-35164469 GACAACATCATCATTGCTTGTGG + Exonic
1107421974 13:40255603-40255625 GATCACTTCTTCAATGCTTCTGG - Intergenic
1113219203 13:108079338-108079360 GATCACATCTGAATTGCTATAGG - Intergenic
1113602031 13:111576525-111576547 AATCACATGATAATTTCTACGGG - Intergenic
1119001924 14:70890042-70890064 CATCAAATCAGCCTTGCTACTGG - Intergenic
1119715404 14:76855553-76855575 GACCACATCAACTTTGCCACAGG + Intronic
1121733702 14:96203950-96203972 GATCCCATCATCATGGAGACAGG - Intergenic
1135227107 16:20670486-20670508 GATAAGATCATCATGGCTGCAGG - Intronic
1138064366 16:53925152-53925174 CCTCACATCAACATTGCCACAGG - Intronic
1139405881 16:66717256-66717278 GCTCTCACCATCACTGCTACTGG + Intergenic
1141287431 16:82685503-82685525 GATCTCATTATCTTTGCTACAGG - Intronic
1151281912 17:73082699-73082721 GATCACATCAGAACTGCTAAAGG + Intronic
1152553005 17:81039180-81039202 GACCACATCAGCACTGCTCCTGG - Intronic
1153252952 18:3141080-3141102 GCTAACAGGATCATTGCTACTGG - Intronic
1157584017 18:48790012-48790034 GATCACAGCTTCATTGCCATGGG + Intronic
1158449919 18:57555066-57555088 GACCATATCATCATTGGTGCAGG - Intronic
1158650958 18:59285270-59285292 AATCACATGATCATTTCAACAGG + Intronic
1164489923 19:28699929-28699951 GATCACTTAAACATTGCTAGTGG + Intergenic
1164493938 19:28740514-28740536 GATCACTCCAACATTGCTGCTGG - Intergenic
928914856 2:36459777-36459799 CATCAGATCATCATTGTTGCTGG + Intronic
929350505 2:40946843-40946865 GATGGCATCATCATTGAAACAGG - Intergenic
934155381 2:89194857-89194879 GACCACATCATCTCTGCTATAGG + Intergenic
934211943 2:89987897-89987919 GACCACATCATCTCTGCTATAGG - Intergenic
935307629 2:101752809-101752831 TTCCACATCATTATTGCTACTGG + Intronic
937871382 2:126788661-126788683 GATCACATCACCTTTTCTGCAGG + Intergenic
942943231 2:181644307-181644329 GATCCCTTCATCATTTCTTCAGG + Intronic
945656608 2:212631974-212631996 GATCCCATCATCATTGCTCAAGG - Intergenic
946558169 2:220882813-220882835 GAACAGATCATCTTTCCTACAGG + Intergenic
1168783577 20:516907-516929 GATCTCATCATCATCCCGACAGG + Intronic
1169028502 20:2389734-2389756 GATCACTTCATCATGTCTTCTGG - Intronic
1170149343 20:13212941-13212963 GATCTCATCATCAATGCTTGTGG - Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1178834291 21:36083527-36083549 GCTCACATCATTAGTGCTGCTGG + Intergenic
1178896332 21:36561650-36561672 GTTCACATCATGCTTTCTACTGG - Intronic
1180987723 22:19915239-19915261 GATCACATCATCATTGCTACTGG - Exonic
1182936426 22:34227037-34227059 GACCACATTATGATTGCTAGGGG - Intergenic
951814043 3:26733485-26733507 GAAGACATCTTCATTGCTTCTGG - Intergenic
953560996 3:43993701-43993723 GATCACACCTACATTGCTGCTGG + Intergenic
956031464 3:65042408-65042430 AATCATACCATCATTGCTAGTGG - Intergenic
957480627 3:80788846-80788868 GTTCACATCATCAGTTCTTCTGG + Intergenic
961639585 3:128356867-128356889 GGTCACATCATCATCTCTAGAGG + Intronic
965711823 3:171563395-171563417 GTTCACCTCATCATGGGTACAGG + Intergenic
966295386 3:178414870-178414892 CATCACATGATAATTGGTACAGG + Intergenic
966399969 3:179538064-179538086 GATCACAGCATCAGAGCCACAGG - Intergenic
971497115 4:27278533-27278555 CATGACATCATAATTGCTTCTGG + Intergenic
973549057 4:52013191-52013213 GATTTCATCCTGATTGCTACTGG - Intronic
973586097 4:52393027-52393049 GATCACATCAAAATTGCTCAAGG - Intergenic
976909995 4:90291418-90291440 GGTCACATCACCCTTGCTACTGG + Intronic
979177994 4:117689196-117689218 GAGCACATCTTCATTACTAGGGG + Intergenic
979248519 4:118537362-118537384 GATCACATTACAGTTGCTACGGG - Intergenic
980237519 4:130128829-130128851 CTGCACATGATCATTGCTACAGG - Intergenic
983246594 4:165294823-165294845 GTTCACATCATAATTCCTACAGG - Intronic
984554181 4:181194467-181194489 GATCAGAGCAGCATTCCTACTGG - Intergenic
987655298 5:20798464-20798486 GATTACTTTATCATTTCTACTGG + Intergenic
987762205 5:22180141-22180163 GATCACATCATGAATGCCACAGG + Intronic
988768261 5:34405438-34405460 GATTACTTTATCATTTCTACTGG - Intergenic
991896992 5:71413603-71413625 GATCACATCATGAATGCCACAGG + Intergenic
994253708 5:97568097-97568119 GATCAGAGCATCATTACTAGGGG - Intergenic
996808546 5:127486687-127486709 GATCACATCATCAAAGCCACTGG - Intergenic
998641314 5:144014480-144014502 GAAAAAATCATCATTGCTATTGG + Intergenic
1014331623 6:120074176-120074198 TAGCACATCATGATTGCTGCAGG - Intergenic
1015479776 6:133695491-133695513 CAACACATGCTCATTGCTACTGG + Intergenic
1016699887 6:147042290-147042312 GCTCACTTCATCATCACTACTGG + Intergenic
1016996106 6:149963411-149963433 GATCACATCATGATTGATCACGG + Intergenic
1019641855 7:2107532-2107554 GATCACAGCATGATTGCAGCGGG - Intronic
1021893416 7:25210296-25210318 GATCACATGATCATCTCAACTGG - Intergenic
1023729221 7:43174253-43174275 TGACACATCATCATTGCTACTGG + Intronic
1032971398 7:137168143-137168165 GCTCACATCATCTTTTCTACAGG + Intergenic
1034476706 7:151288806-151288828 AATGACCTCCTCATTGCTACAGG - Intergenic
1037467718 8:19176211-19176233 TATCACATAATCATTACAACAGG + Intergenic
1044832323 8:96262066-96262088 GTTCACATCATCCTTGCTTAGGG - Exonic
1046223670 8:111248637-111248659 CATCACATCATCATTGCAAAAGG + Intergenic
1052654650 9:31340858-31340880 GAACACATCCTCATTGTTAAGGG + Intergenic
1055585071 9:77750451-77750473 GATAACATGATCATTACTAGTGG - Intronic
1056707052 9:88960152-88960174 GATAACATCTTCATGGCTTCTGG - Intergenic
1056896650 9:90557138-90557160 GGACACTTCATCAATGCTACAGG + Intergenic
1193899775 X:87163016-87163038 GATTATGTTATCATTGCTACAGG - Intergenic
1195473984 X:105263476-105263498 GATATCATCATCATACCTACAGG - Intronic
1197839965 X:130735786-130735808 GATTACATCATCATTCCTACTGG - Intronic
1201674605 Y:16565533-16565555 GTTCACACCATCATCTCTACAGG + Intergenic