ID: 1180988069

View in Genome Browser
Species Human (GRCh38)
Location 22:19917281-19917303
Sequence CTGTGGGGCTCTGTATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180988069_1180988076 26 Left 1180988069 22:19917281-19917303 CCAGGGGATACAGAGCCCCACAG No data
Right 1180988076 22:19917330-19917352 TGTGGCTTAGCTCCCTGGATAGG 0: 1
1: 0
2: 1
3: 14
4: 133
1180988069_1180988077 27 Left 1180988069 22:19917281-19917303 CCAGGGGATACAGAGCCCCACAG No data
Right 1180988077 22:19917331-19917353 GTGGCTTAGCTCCCTGGATAGGG 0: 1
1: 0
2: 0
3: 16
4: 92
1180988069_1180988073 8 Left 1180988069 22:19917281-19917303 CCAGGGGATACAGAGCCCCACAG No data
Right 1180988073 22:19917312-19917334 AGAAATGCCACAGCACAATGTGG No data
1180988069_1180988075 21 Left 1180988069 22:19917281-19917303 CCAGGGGATACAGAGCCCCACAG No data
Right 1180988075 22:19917325-19917347 CACAATGTGGCTTAGCTCCCTGG No data
1180988069_1180988078 28 Left 1180988069 22:19917281-19917303 CCAGGGGATACAGAGCCCCACAG No data
Right 1180988078 22:19917332-19917354 TGGCTTAGCTCCCTGGATAGGGG 0: 1
1: 0
2: 0
3: 6
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180988069 Original CRISPR CTGTGGGGCTCTGTATCCCC TGG (reversed) Intronic
No off target data available for this crispr