ID: 1180988968

View in Genome Browser
Species Human (GRCh38)
Location 22:19922516-19922538
Sequence TCTGGGATCTTGAACACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180988968 Original CRISPR TCTGGGATCTTGAACACTGA AGG (reversed) Intronic
900358564 1:2276538-2276560 TATGGGATCTAAAACACTGCAGG - Intronic
902146189 1:14401393-14401415 TCTCGTATGTTGAACACAGAGGG + Intergenic
905480891 1:38261269-38261291 TCTGGGATCTGGCACACAGTCGG + Intergenic
906789195 1:48643821-48643843 TTTGGGATCTGGAATCCTGAAGG + Intronic
907634575 1:56120858-56120880 TCTGGGATGTTGATTATTGAGGG - Intergenic
907959409 1:59264470-59264492 TCTGGGATGTGGACCAGTGAGGG + Intergenic
908029774 1:59987039-59987061 TCTGGGAACTGGAACAAAGATGG - Intergenic
911083868 1:93960021-93960043 TCTGAAATCTGGAACACTTATGG + Intergenic
915205211 1:154265341-154265363 TCTGCTATCAGGAACACTGATGG - Intronic
915973549 1:160370659-160370681 TCTGGGAGCTTGAAAGCTGGTGG - Exonic
918338487 1:183546176-183546198 TCTGGGACCTTGACTTCTGAGGG - Exonic
918754116 1:188314701-188314723 TCTGAGATCTGAAACATTGAAGG + Intergenic
919002149 1:191846582-191846604 TCTTGTATCTTGAACACTGCAGG + Intergenic
920302888 1:205000183-205000205 TCTGGTGTCTGGACCACTGAGGG + Intronic
923251692 1:232184299-232184321 TCTGGGGTCTTGAAATATGAAGG + Intergenic
1063658578 10:8016422-8016444 TCTGGCCTCTTGAACAACGAGGG - Exonic
1064867175 10:19894190-19894212 TCTGGGATCTTGAAGACTTCAGG - Intronic
1068901060 10:62269287-62269309 TCTGGGATTATAAACACTGGGGG - Intergenic
1069540631 10:69291314-69291336 TCTGGGATCTCAGACACAGATGG + Intronic
1069899906 10:71701368-71701390 TGTGGGATCTGGGACACTAAGGG + Intronic
1070130329 10:73651353-73651375 CCTGGGATATTGGACACTCAGGG + Intronic
1072640284 10:97206425-97206447 TCTGGGATCTGGAAGCCTGGGGG + Intronic
1074267669 10:111920943-111920965 TCTGGAATCTTGCACTATGAAGG + Intergenic
1074470793 10:113724881-113724903 TCTGTGATCTTGACTACTCAGGG + Intronic
1075081598 10:119387642-119387664 TGTGGCATCTTGGAGACTGATGG + Intronic
1075815856 10:125264345-125264367 GCTGGGAGCTTGAAACCTGATGG + Intergenic
1076662263 10:132063366-132063388 TCTGGGATCTGGAAGAATTAGGG + Intergenic
1084683769 11:70681845-70681867 CCAGAGATCTTGAACACTGTGGG + Intronic
1085788888 11:79478734-79478756 TCAGGGATCTAGAATGCTGAAGG - Intergenic
1087155489 11:94897641-94897663 CCTGGGATCCTGAACAATTAAGG - Intergenic
1087622843 11:100562489-100562511 TGTTGGATCTTGAAGACTGTGGG + Intergenic
1089069263 11:115686897-115686919 TTTGAGATCTGGAACACAGAAGG + Intergenic
1090215188 11:124955705-124955727 TCTGAGATCAAGTACACTGAGGG - Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1092170449 12:6370845-6370867 TTGGGGTTCTTGAACAATGAAGG - Intronic
1093132934 12:15414354-15414376 TCTGGGATCTTGAATGCTTCTGG - Intronic
1099109337 12:78537942-78537964 TCAGCGACATTGAACACTGATGG + Intergenic
1099855710 12:88163497-88163519 TCTGGCCTCTTGAACTGTGAGGG - Intronic
1099948939 12:89278400-89278422 TCTTGTATCTTGAACAGTGTGGG - Intergenic
1101066611 12:101027938-101027960 TCTGGGATCTCTAACCCGGAGGG - Intronic
1112063477 13:95766340-95766362 TCTGAGATCTTGAAAAATCAAGG + Intronic
1112722270 13:102258506-102258528 TCTGGGAGCTTGGGCATTGATGG + Intronic
1115470429 14:33763183-33763205 TCTGGGATGCTGAACACAGGAGG + Intronic
1115715203 14:36095713-36095735 TATGGAATTTTGAACACTTAAGG + Intergenic
1124027594 15:25981250-25981272 GCTGGGCTCTTGAATATTGATGG - Intergenic
1125893737 15:43285126-43285148 TGTGGGATGTTGATCACTGATGG - Intronic
1126403620 15:48300415-48300437 TGTGGGATTTTGGACAGTGAAGG + Intronic
1127328629 15:57918170-57918192 TCTGGGCTCTGGGACACTGGAGG - Intergenic
1128750748 15:70147433-70147455 TCTGAGATCTTGGAAACTGCTGG + Intergenic
1129140571 15:73594413-73594435 TCCTGGATCTTTAACACTTAAGG - Intronic
1130375633 15:83326386-83326408 TCTGGAAGCCTGAACCCTGAAGG + Intergenic
1131226132 15:90625819-90625841 TTGGGGACCTTGAACACTGGAGG + Exonic
1131228512 15:90644194-90644216 TCTGAGATCTTGAGCACAAAGGG - Intronic
1132269668 15:100512579-100512601 TCTGGGATATTGAGCACCCAAGG - Intronic
1140984419 16:80144251-80144273 TCTGGTATCTGTAACAGTGAGGG + Intergenic
1148702506 17:49597894-49597916 TCTGGGATCTTCAATATTTATGG - Intergenic
1149351672 17:55794835-55794857 TCTGGGGACTTCATCACTGAAGG - Intronic
1149958164 17:61076728-61076750 TCTGGGCTCTGTGACACTGATGG + Intronic
1151200753 17:72466125-72466147 TCTGGGATTTTTGACACTGAAGG + Intergenic
1151378562 17:73708785-73708807 GCTGGGATCTGGAACAATGGTGG - Intergenic
1152860266 17:82692292-82692314 TCTTGGATCTTGGACCCTGTCGG - Intronic
1153663780 18:7350055-7350077 CCTGGGTTCTTGAAGACTTAGGG + Intergenic
1156622429 18:38868498-38868520 TTTGGGATTTTAAACAATGATGG - Intergenic
1159203021 18:65212514-65212536 TTTGAGATCTTGTACTCTGATGG - Intergenic
1162103570 19:8355646-8355668 TCTGGGAACTTGTACATTGCAGG - Intronic
1168502761 19:56907367-56907389 TCTGGGAACCTGTACAGTGAGGG - Intergenic
928401881 2:30984912-30984934 GCTGGGTGCCTGAACACTGAGGG + Intronic
928442221 2:31302104-31302126 ACTGGGCACTTGAACACTGAAGG - Intergenic
929523383 2:42676175-42676197 TTTGTGTTCCTGAACACTGAAGG - Intronic
936376471 2:111945660-111945682 TCAGGGAACTTGAACTCTAATGG + Intronic
939322844 2:140647030-140647052 TCTGGGATTTTGAACACTAATGG + Intronic
941003609 2:160225507-160225529 GCTGGGATCTTGCACACAGTAGG - Intronic
943236289 2:185324659-185324681 TTTGACATCTTTAACACTGATGG + Intergenic
947537763 2:230951662-230951684 GCTGGGATCTTGACAACTGAGGG + Intronic
947983168 2:234427002-234427024 TCTTGGCTCTTGAACAGTGGGGG - Intergenic
948063395 2:235058677-235058699 GCTGGAATCTGGACCACTGATGG - Intergenic
948636926 2:239344592-239344614 TCTGGGATCTTAATCAGTCAAGG - Intronic
1171089841 20:22274190-22274212 TCTGTGATCATGACCACTCATGG + Intergenic
1173145757 20:40522746-40522768 TCTGGCATGGTGACCACTGATGG - Intergenic
1175365832 20:58455508-58455530 TCTGGAATCTGGAAAGCTGATGG - Intergenic
1178398073 21:32260143-32260165 TGTGGGACCTTGTACACTGGAGG - Intergenic
1179314115 21:40225886-40225908 TCTGGGATCTTGGTCAATGGTGG - Intronic
1179832807 21:44008552-44008574 TTTGGGATCTTGAAGGCAGATGG - Intergenic
1180988968 22:19922516-19922538 TCTGGGATCTTGAACACTGAAGG - Intronic
1184052628 22:42019524-42019546 TTTGGGATTTTCCACACTGAAGG + Intronic
1184741505 22:46431375-46431397 TCTGGAGTGTTGAGCACTGATGG + Intronic
1184754035 22:46506389-46506411 TCTGAGATCTGGGAAACTGAGGG - Intronic
950619610 3:14194125-14194147 TCTGGAATCTTCAACCCAGAGGG + Intronic
951664829 3:25111329-25111351 TCTGCCATCTTGACCACTGTTGG + Intergenic
953460271 3:43076418-43076440 TGTGGGAACTTGAACACATAAGG - Intergenic
954807134 3:53227096-53227118 TCTGGGTTCTTGGATACTGCGGG - Intronic
957584253 3:82114258-82114280 TCTGGGATCTCTAACCTTGATGG + Intergenic
959441709 3:106384359-106384381 TCTGGAATCAGGAACTCTGAGGG + Intergenic
959500320 3:107099459-107099481 TCTGGGATAGAGGACACTGAGGG - Intergenic
959824670 3:110779407-110779429 GCTGAGATATTTAACACTGAAGG + Intergenic
960421679 3:117454122-117454144 TCTGGGCTCTTCAATACTAAGGG - Intergenic
963374101 3:144440833-144440855 TCTGTTATCTTGAACACTTTAGG - Intergenic
966939105 3:184734219-184734241 TCTGGGATCTGGAGTACAGAGGG + Intergenic
969272277 4:6111006-6111028 CCTGGAATCTTGAACACCTAGGG + Intronic
971613248 4:28753796-28753818 TCTGGGACTATGAAGACTGAGGG + Intergenic
973099439 4:46246251-46246273 TCTGAGCTCTTAAATACTGATGG + Intergenic
973803401 4:54500416-54500438 CCTGGGATTTTAAACACTGGAGG + Intergenic
975181828 4:71354937-71354959 TGTGGGATTTTGAACACCGAAGG + Intronic
975261679 4:72309562-72309584 TCTGGGATGTTGACCACTACTGG - Intronic
976748717 4:88432313-88432335 TCTGAGATCTGAAACACTGCTGG + Intronic
978024947 4:103861863-103861885 TCTTGGATTTTCAACTCTGAGGG + Intergenic
983486829 4:168342276-168342298 TCTGGAATATGGCACACTGATGG + Intergenic
983976720 4:173943873-173943895 TCTGTGATCTGGTACCCTGAGGG + Intergenic
986756105 5:10838197-10838219 TCTAGGACCTTGAACACTGGGGG - Intergenic
989067469 5:37478804-37478826 TCTGGGATTTTGCCTACTGATGG - Intronic
991122185 5:63029391-63029413 TCTGGGAACCTGAAAAATGAGGG - Intergenic
991622222 5:68556740-68556762 TTGGGGATTTTGAACACTGCTGG - Intergenic
991655037 5:68895552-68895574 TCTGAGATGTGGAACACTCAGGG - Intergenic
991905514 5:71506204-71506226 TCTGGGTTTTAGAACACTGGTGG + Intronic
992109580 5:73480446-73480468 TCTGGGTCCTGAAACACTGAAGG - Intergenic
993841623 5:92887064-92887086 ACTGGGGTCTTGATGACTGAAGG - Intergenic
996144881 5:119962421-119962443 TCTGGGTTCTTGATCAGTGAAGG - Intergenic
996904640 5:128584217-128584239 TCTGGGATTTTGAAGGCTGGTGG + Intronic
997752653 5:136362807-136362829 TCAAGGATCTTGAACTCTAATGG - Intronic
997968415 5:138379587-138379609 CCTGTGACCTTGAACACTGTAGG - Exonic
999696565 5:154192208-154192230 TCTGGCATCTGGAGCACAGAGGG + Intronic
1000762141 5:165239581-165239603 TGTAGGATTTTGAACACAGATGG + Intergenic
1001849292 5:174949875-174949897 TCTGTGATGCTGAACAATGAGGG - Intergenic
1001882605 5:175257785-175257807 TTTGGGACCTTCAACACTGAGGG - Intergenic
1003668880 6:8137181-8137203 CCTGTCATCTTGAACAGTGACGG + Intergenic
1005836867 6:29716819-29716841 TCTGGGATCATGAACTCTGGGGG + Intergenic
1005845852 6:29777854-29777876 TCTGGGATCATGAGCTCTGGGGG + Intergenic
1005858633 6:29884342-29884364 TCTGGGATCATGAGCTCTGGGGG + Intergenic
1005866185 6:29939169-29939191 TCTGGGATCATGAGCTCTGGGGG + Intergenic
1005942828 6:30573634-30573656 TCTGGGATCTTGCTCACTCCTGG - Intronic
1006113391 6:31762312-31762334 CCTGGGATCTTGAAGATTTAGGG - Intronic
1011768508 6:90650268-90650290 TCTGTTATCTTGCCCACTGAAGG - Intergenic
1014484680 6:121984605-121984627 TCTGGGATCTCTGACCCTGAGGG + Intergenic
1014569821 6:122995956-122995978 TCTGGGGTCTTGCACACAAAGGG + Exonic
1016528892 6:145036516-145036538 TCTGGGATTTTGTGCACTGGAGG - Intergenic
1018112163 6:160546323-160546345 TCTGGGTTGCTGAACACTTAGGG + Intronic
1018462813 6:164015182-164015204 CCTGGGATCTTGGTCTCTGAAGG - Intergenic
1019138010 6:169923408-169923430 TCTGGAATCTTCACCACTTAGGG - Intergenic
1019899131 7:4006327-4006349 TCTCAGATCTAGAAGACTGAGGG - Intronic
1021589928 7:22249815-22249837 TCTGGCATCTGAATCACTGAGGG + Intronic
1023303960 7:38803761-38803783 AATGGGGTCTTGAACCCTGAAGG + Intronic
1024584470 7:50829665-50829687 TCTAGTATCTTGAAAGCTGATGG + Intergenic
1025249653 7:57343459-57343481 TGTGTTATCTTGGACACTGATGG + Intergenic
1028852896 7:95556547-95556569 TCTAGAATGTTGAACATTGATGG + Intergenic
1031485903 7:122323730-122323752 TCTGAAATCTTGAACACAGTAGG + Intronic
1032613145 7:133438252-133438274 CCTGGCCTCTTGCACACTGATGG + Intronic
1032687386 7:134249279-134249301 TCTGGGACCTTGAATCTTGAGGG + Intronic
1033649000 7:143326446-143326468 TGTTGGATCTTGCACACTCAGGG + Intronic
1034405671 7:150901049-150901071 TCTGGGACCTGGAACACAGCAGG + Intergenic
1034536642 7:151729556-151729578 TCGGGGGTCTTGAGCACCGATGG - Intronic
1034939763 7:155222881-155222903 TTGGGAATCTTGAACACTCATGG + Intergenic
1037706412 8:21319157-21319179 TCTGGGCTCTAGAACAGTGTGGG + Intergenic
1039265434 8:35818222-35818244 TCTGGAATATAGCACACTGATGG - Intergenic
1039450682 8:37672643-37672665 TCTGTGATATAGAACAATGAGGG - Intergenic
1039611309 8:38921487-38921509 TCTTGGAACTTGAATATTGACGG + Intronic
1040959850 8:53019676-53019698 TCTGGGATCTTCTACCTTGAGGG - Intergenic
1043189951 8:77206358-77206380 TTTTAGATCTTGAACACTGAGGG + Intergenic
1043229976 8:77788896-77788918 TCTGGGAACTCCATCACTGAAGG + Intergenic
1046589337 8:116187228-116187250 TCTGGAGTGTTTAACACTGATGG + Intergenic
1048444830 8:134485530-134485552 TCTGGAATCCTTGACACTGATGG + Intronic
1048952745 8:139509705-139509727 TGTGGGAACTTGAACACAGAGGG + Intergenic
1048965732 8:139613292-139613314 TCTGGGATCTTCAACATAGAAGG + Intronic
1051436441 9:17038228-17038250 TCTGGTTTCTTGGAGACTGAAGG + Intergenic
1051972180 9:22902476-22902498 TATGGGATATGGGACACTGAGGG - Intergenic
1052169980 9:25381715-25381737 TCTTAGATCATGAACACAGATGG - Intergenic
1056575432 9:87852890-87852912 TCTGGGATCTAAAACTCTGCAGG - Intergenic
1058537444 9:105976861-105976883 TCTGAGATCTTGCATCCTGAAGG + Intergenic
1059313937 9:113408429-113408451 TCTGTGATCTGGAACACAGCAGG + Exonic
1062677875 9:137758750-137758772 TTTAGGGTTTTGAACACTGAGGG + Intronic
1185684235 X:1914893-1914915 GCTGGGATCTTGAACACTCCTGG + Intergenic
1186568111 X:10686165-10686187 TCTGTGATCTTGAGAGCTGATGG + Intronic
1188015302 X:25101694-25101716 TATGATATATTGAACACTGATGG - Intergenic
1188492568 X:30753262-30753284 TCTGGAATTTTGACCACAGAAGG - Intergenic
1190538053 X:51448535-51448557 TTTGGGATGATGAGCACTGAAGG + Intergenic
1192631227 X:72779389-72779411 TCTGAGATCTGAAGCACTGAAGG + Intronic
1192650482 X:72941412-72941434 TCTGAGATCTGAAGCACTGAAGG - Intronic
1194116943 X:89912287-89912309 TCTGTCATCTTGCTCACTGAAGG + Intergenic
1194501788 X:94690592-94690614 TCTGGGATCTGGAGGACTGGAGG - Intergenic
1196144215 X:112298765-112298787 TCTGGGATCTAGAACAGAAAAGG - Intergenic
1196388407 X:115184877-115184899 TCTGGGTTTTTGAGAACTGATGG - Intronic
1198940819 X:141953149-141953171 TCTGGAGTCTTGAACTCTGGGGG + Intergenic
1200469735 Y:3569454-3569476 TCTGTCATCTTGCTCACTGAAGG + Intergenic