ID: 1180989402

View in Genome Browser
Species Human (GRCh38)
Location 22:19925868-19925890
Sequence CCGGCCCTGCACTTTCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180989402_1180989408 13 Left 1180989402 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1180989408 22:19925904-19925926 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1180989402_1180989409 14 Left 1180989402 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1180989409 22:19925905-19925927 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1180989402_1180989415 26 Left 1180989402 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1180989415 22:19925917-19925939 AGCACTTTGGGAGGCCGAGGCGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
1180989402_1180989413 23 Left 1180989402 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1180989413 22:19925914-19925936 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
1180989402_1180989417 30 Left 1180989402 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1180989417 22:19925921-19925943 CTTTGGGAGGCCGAGGCGGGTGG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
1180989402_1180989416 27 Left 1180989402 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1180989416 22:19925918-19925940 GCACTTTGGGAGGCCGAGGCGGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
1180989402_1180989411 17 Left 1180989402 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1180989411 22:19925908-19925930 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180989402 Original CRISPR CCGGCCCTGCACTTTCTTGA TGG (reversed) Intronic
902872205 1:19321011-19321033 CCGTCTTTTCACTTTCTTGATGG + Intronic
904658451 1:32067105-32067127 CTGGCCCGACACTTTCTTGATGG - Intergenic
913073537 1:115322183-115322205 CCTGCCCAGCACTTTCTGGCAGG + Intronic
914857954 1:151365787-151365809 CCAGCCCTTCACTTTCTTGGGGG + Exonic
919178287 1:194047921-194047943 CCGGCCCTGAATTTTCTTATAGG + Intergenic
919820336 1:201468436-201468458 CCGGGCCCGCACTGTCTGGATGG + Exonic
920175239 1:204097070-204097092 TCGCCCCTGCCCTCTCTTGATGG - Intronic
922007392 1:221545733-221545755 CCTGCCCTTCAGTCTCTTGATGG - Intergenic
1067035828 10:42915893-42915915 CCTGGCCTGCTGTTTCTTGATGG - Intergenic
1069562486 10:69440658-69440680 CCAGCCCTGCACTGTCAGGAAGG + Intergenic
1070555585 10:77525390-77525412 CCAACCCTGCACTTTCTGGGTGG - Intronic
1075503583 10:123001299-123001321 CCCGGCCTTCACTTTCTTAATGG + Intronic
1075731735 10:124640417-124640439 CAAGCCCTGCACATTCTTCAGGG - Intronic
1076565729 10:131397800-131397822 CCGTGTCTGCCCTTTCTTGATGG + Intergenic
1077038934 11:509105-509127 CCAGCCCTGAGCTTTCTTGGGGG - Intergenic
1077676743 11:4201400-4201422 CCCACCCTGCACTTTCTGGCGGG + Intergenic
1084161226 11:67351435-67351457 TCGGCCTAGGACTTTCTTGAAGG + Intronic
1086115768 11:83247945-83247967 CTGGCCCTGCAGTTCTTTGATGG - Exonic
1089893006 11:121900009-121900031 CCTGCCCTGCACTTGAATGATGG - Intergenic
1090766617 11:129881738-129881760 CCAGCCCTGCAGTATCTTGCTGG - Exonic
1091055910 11:132418817-132418839 CCTGACATGTACTTTCTTGAAGG + Exonic
1094144876 12:27218027-27218049 CTGGGCCTGTACTTTCTTCATGG + Intergenic
1094776671 12:33737410-33737432 ACGACCCTGCACTTCCATGAGGG + Intergenic
1097537114 12:60886126-60886148 CTGGCCCTGGACTTTTTTGGGGG + Intergenic
1097593185 12:61596499-61596521 CCAGCCCTCAACTTTCTGGATGG + Intergenic
1099115639 12:78620888-78620910 CCTTCCCTTCCCTTTCTTGATGG - Intergenic
1101054922 12:100902703-100902725 ACGGCCCTGGTGTTTCTTGATGG - Intronic
1104800221 12:131549844-131549866 CTGGCCTTCCACTTTCTTGATGG + Intergenic
1107468252 13:40667571-40667593 CCGGCCCTGGACTTAGTGGACGG - Intergenic
1110052645 13:70923831-70923853 CTTGGCCTGCACCTTCTTGATGG - Intergenic
1118701692 14:68439634-68439656 CCTGGCCTGGACTGTCTTGAAGG + Intronic
1120302509 14:82726098-82726120 CAGAACCTGCACTTTCCTGATGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122980848 14:105191802-105191824 CCGCCCCTGCACTCTCCGGAAGG - Intergenic
1123955932 15:25334668-25334690 CCAGCACCGCACTGTCTTGATGG - Intronic
1126116012 15:45208221-45208243 CCTGGCCTGCTCTTTCTTCAAGG + Intergenic
1128600706 15:68993194-68993216 CCAGCCATGCACTTTCTGCATGG + Intronic
1129198589 15:73985362-73985384 CTGGCCCTGCACTTCCTGGGAGG - Exonic
1130737954 15:86570374-86570396 CCTGTCCTCCCCTTTCTTGAGGG - Intronic
1132196578 15:99918333-99918355 CTGGCCTTGCCCTTTCTTGCGGG - Intergenic
1136129566 16:28211516-28211538 GCGGCCCTGCCCTTTTTAGAGGG - Exonic
1139370304 16:66463589-66463611 CTGTCTCTTCACTTTCTTGAAGG + Intronic
1140246195 16:73252305-73252327 CCTGCCCTGCACATTCCTGTAGG - Intergenic
1141839116 16:86563128-86563150 CTGGCCCTGCCCTTTGTCGATGG + Intergenic
1142348269 16:89568082-89568104 CCGGCCCCACACTTTGTTGATGG + Intergenic
1146934918 17:36807517-36807539 GCTGCCCTGTACTTTCTTGAGGG - Intergenic
1147626736 17:41905271-41905293 CCTCCCCTGCACTTGTTTGAAGG + Intronic
1148697155 17:49567546-49567568 CAGGCCCGGCACTCTCTGGAGGG - Intergenic
1150920370 17:69476339-69476361 CCGGCCCTGGAATTTCTGCAAGG - Intronic
1151246225 17:72796999-72797021 CCGTCCCTGAACTTTCCTGAGGG + Intronic
1154221185 18:12455633-12455655 CCGGCCCCGCACTTGATTGGTGG + Intronic
1154371663 18:13768921-13768943 CTGGCCCTGGACTTTCTGGTTGG - Intergenic
1159640884 18:70861922-70861944 CAGGCCCTGGCCTTTTTTGATGG + Intergenic
1160093277 18:75846804-75846826 CTGCCCCTGCTCATTCTTGATGG - Intergenic
1160155846 18:76433353-76433375 CCAGACCTGCTTTTTCTTGAGGG - Intronic
1163816935 19:19472232-19472254 CCAGTCCTGCACTTTCCTGTAGG + Intronic
1164550884 19:29211750-29211772 TGGGCTCTGCACTTTCTTCATGG - Intronic
1165071676 19:33259448-33259470 CCAGCCCTGCAGTTTATTGAAGG + Intergenic
1165578021 19:36838337-36838359 CCGGCCCTGCGGTCCCTTGATGG + Exonic
926138010 2:10350631-10350653 CTGTCTCTTCACTTTCTTGACGG - Intronic
929579158 2:43070831-43070853 CAGGCCCCGCGCTTTCTTGGGGG + Intergenic
929645808 2:43626266-43626288 CCCGGCCTTTACTTTCTTGATGG - Intergenic
931617288 2:64172928-64172950 CTGGCCTTGCACTTTAGTGATGG - Intergenic
931842573 2:66169780-66169802 CCTGGCCTGCTGTTTCTTGAAGG + Intergenic
933918095 2:87016949-87016971 GCGGCCCTGCACTTTCTGAGGGG - Intronic
934004899 2:87752965-87752987 GCGGCCCTGCACTTTCTGAGGGG + Intronic
934871364 2:97869403-97869425 CTGGCCCTGCCCTTTCTTCCAGG + Intronic
935767858 2:106386996-106387018 GCGGCCCTGCACTTTCTGAGGGG + Intergenic
936154668 2:110040199-110040221 CCGGCCCTGCATGTCCCTGAGGG + Intergenic
936190015 2:110331215-110331237 CCGGCCCTGCATGTCCCTGAGGG - Intergenic
939183007 2:138825955-138825977 CCAGCACTGCCCTTTCCTGAGGG - Intergenic
944681325 2:202079592-202079614 CCACCCTTGAACTTTCTTGATGG + Intronic
949051160 2:241898252-241898274 CCGGCCTTGGACATTCTTGATGG - Intronic
1171067707 20:22034694-22034716 CTGACCCTTCACTTTCTTCAGGG + Intergenic
1179429787 21:41312931-41312953 TCTGCCCTGCCCTTCCTTGAAGG - Intronic
1180989402 22:19925868-19925890 CCGGCCCTGCACTTTCTTGATGG - Intronic
1181751247 22:24990680-24990702 CTGGCCTTGCCCTTCCTTGAAGG + Intronic
1184128047 22:42501343-42501365 CCGCCCCAGCACATTCTAGAAGG + Intergenic
1184136838 22:42554656-42554678 CCGCCCCAGCACATTCTAGAAGG + Intronic
950187802 3:10956146-10956168 CCATTCCTGCACTTTGTTGAGGG + Intergenic
950537031 3:13584655-13584677 TCAGCCCTGCTCTTTCTTGAGGG - Intronic
950688072 3:14633281-14633303 CAGGTCTTGGACTTTCTTGAGGG - Intergenic
954305111 3:49721533-49721555 CTGGCCCTGGCCCTTCTTGAGGG + Exonic
956677252 3:71747566-71747588 CGGGCCTTTCATTTTCTTGATGG + Intronic
956920139 3:73919422-73919444 ACCGCCCAGCCCTTTCTTGACGG - Intergenic
961701541 3:128748497-128748519 CAGGGGCTGCACTCTCTTGATGG + Intronic
962943995 3:140151043-140151065 CCTGCCCTGTACCTTCTTGGTGG + Intronic
964660981 3:159120180-159120202 CTGGCCCTGCACTTTGGAGAGGG + Intronic
966863198 3:184241904-184241926 CGGGCCCAGCACTTGCCTGACGG + Exonic
968187530 3:196643526-196643548 CCGGTCCTTCTCTTTCTTGGAGG - Intronic
968504208 4:964498-964520 CCGGCCCTGCCCTGTCTCCACGG + Intronic
968961447 4:3746449-3746471 CTGGCCCTCCACGTTCCTGATGG - Intergenic
975631207 4:76404231-76404253 TCTGCCATGCACTTTCTTTATGG - Intronic
976105952 4:81617785-81617807 CTGAACCTGAACTTTCTTGATGG + Intronic
982232293 4:153220464-153220486 CTGTCCTTTCACTTTCTTGATGG - Intronic
983247557 4:165305704-165305726 CCTGCCCTGCACCTCCTGGAAGG - Exonic
985085932 4:186312416-186312438 CCAGCCCTGCTCCTTATTGAGGG - Intergenic
993655036 5:90567433-90567455 CTGGTCCTGGACTTTCTTCATGG + Intronic
996255324 5:121394936-121394958 CTGGCCCTGGAGTTTCTTTATGG - Intergenic
997752232 5:136357349-136357371 CCGGCGCTGCATGTTTTTGAAGG + Exonic
1000780046 5:165468871-165468893 CTGGTCCTGGACTTTCTTGTTGG - Intergenic
1005958888 6:30682807-30682829 CCTGCCCTGCACTTGCTTCCTGG + Intronic
1006194762 6:32232429-32232451 CCCAGCCTTCACTTTCTTGATGG - Intergenic
1013417129 6:109934921-109934943 CAGGCCCTGCACATTGTTGGTGG + Intergenic
1014845889 6:126276524-126276546 CCAGCCCTGCTCCTCCTTGAGGG + Intergenic
1018737822 6:166702111-166702133 CAGCCCCTGCATTTTCTTTACGG + Intronic
1023296940 7:38724890-38724912 CTGGCCCTGTAATTTCTTAAAGG + Exonic
1024345695 7:48310807-48310829 CAGGCCCAGCACTTTCCGGACGG + Intronic
1028731236 7:94150852-94150874 CTGACCTTTCACTTTCTTGATGG - Intergenic
1029033198 7:97490502-97490524 CCCGCCCTGCACCTGGTTGATGG - Intergenic
1029067064 7:97860803-97860825 CCGTCTTTTCACTTTCTTGATGG + Intronic
1032639593 7:133750876-133750898 CCAGCCTTGAACTTTTTTGATGG + Intronic
1034018097 7:147609233-147609255 CCGGCCCACCACCTTCTTAAAGG - Intronic
1035642142 8:1192089-1192111 TGGCCCCTGCACTTTCTAGATGG + Intergenic
1035855968 8:2976642-2976664 CCTGGCCTCCACTTTCTTTATGG + Intronic
1038442429 8:27581083-27581105 CTGGCTTTTCACTTTCTTGATGG + Intergenic
1039292736 8:36113878-36113900 CAGGCTCTCCCCTTTCTTGAGGG + Intergenic
1043889926 8:85643694-85643716 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043891464 8:85655602-85655624 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043892537 8:85662439-85662461 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043893020 8:85714896-85714918 CAGGCCCTTCAGTCTCTTGAGGG - Intergenic
1043895707 8:85736350-85736372 CAGGCCCTTCAGTCTCTTGAGGG - Intergenic
1043896972 8:85745458-85745480 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043899296 8:85763825-85763847 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043900906 8:85776019-85776041 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043902870 8:85791294-85791316 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043904480 8:85803487-85803509 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043906092 8:85815678-85815700 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1043907700 8:85827868-85827890 CAGGCCCTTCAGTCTCTTGAGGG + Intergenic
1049813713 8:144588218-144588240 GCGGCCCTGCTCTGTCTTGCTGG - Intronic
1054981606 9:71212597-71212619 TCAGCCATGCACCTTCTTGATGG - Intronic
1055398466 9:75898066-75898088 CCTGATCTGCACTTTCTTCATGG + Intronic
1057801902 9:98195914-98195936 CCTTCCCTGCTCTTTCTGGAGGG - Intergenic
1059338606 9:113584354-113584376 GCGGCCCAGCTCTTTCTTGAGGG - Exonic
1061001567 9:127905634-127905656 CTGGCCCTGCCCTTCCTTGGTGG - Intergenic
1061127935 9:128688850-128688872 CCGGGCCTGCACTTTCGGGGTGG + Intronic
1061257962 9:129463766-129463788 CTGGCCCTGCAGCTTCTTGTGGG + Intergenic
1186211520 X:7254876-7254898 CCGGCCCAGAACTTTCTTGTAGG + Intronic
1188495258 X:30776472-30776494 CCTGGCCTTCACTTTCTTAATGG + Intergenic
1197776126 X:130119745-130119767 CCGCCCCTTCCCTTTCTTTATGG + Intergenic
1200097026 X:153669257-153669279 CCCTCCCTTCCCTTTCTTGATGG - Intergenic