ID: 1180995744

View in Genome Browser
Species Human (GRCh38)
Location 22:19964427-19964449
Sequence CACCTGAGGTCTGGGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180995734_1180995744 18 Left 1180995734 22:19964386-19964408 CCAGTAGAGCCCTGTGTGGACAC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1180995744 22:19964427-19964449 CACCTGAGGTCTGGGAGTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 292
1180995732_1180995744 27 Left 1180995732 22:19964377-19964399 CCAGGCATTCCAGTAGAGCCCTG 0: 1
1: 0
2: 0
3: 11
4: 157
Right 1180995744 22:19964427-19964449 CACCTGAGGTCTGGGAGTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 292
1180995735_1180995744 9 Left 1180995735 22:19964395-19964417 CCCTGTGTGGACACAGCTCGCTC 0: 1
1: 0
2: 3
3: 15
4: 171
Right 1180995744 22:19964427-19964449 CACCTGAGGTCTGGGAGTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 292
1180995736_1180995744 8 Left 1180995736 22:19964396-19964418 CCTGTGTGGACACAGCTCGCTCT 0: 1
1: 0
2: 3
3: 13
4: 127
Right 1180995744 22:19964427-19964449 CACCTGAGGTCTGGGAGTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180995744 Original CRISPR CACCTGAGGTCTGGGAGTGT GGG Intronic
901536663 1:9886885-9886907 CTCCTGAGGCCTGAGAGTCTGGG - Intronic
901553831 1:10016176-10016198 CACCAGAGCTCTGGGGGTGGGGG + Intergenic
902209680 1:14895514-14895536 CATCAGGGGTCTGGGAGTGAAGG + Intronic
902467174 1:16625594-16625616 CAACTGAGGTATGGGAGGTTGGG + Intergenic
902507415 1:16947151-16947173 CAACTGAGGTATGGGAGATTGGG - Intronic
902634660 1:17727199-17727221 CAGCTGTGGTCTTGGAGTCTAGG - Intergenic
903075974 1:20766719-20766741 CACCTGAGGTCAGGAGGTGGAGG + Intronic
903154593 1:21435409-21435431 CCCCTGAGATGTGGCAGTGTGGG + Intergenic
903532690 1:24043965-24043987 CACTTGAGCTCTGGGAGTCGAGG - Intergenic
903634942 1:24806265-24806287 CACCTGAGGCCTGAGAGGGCAGG + Intronic
904734075 1:32616865-32616887 CACCTGAGGCCAGGAAGTCTAGG - Intronic
905429024 1:37908260-37908282 GACCTGAGGTCACGGAGTGAGGG - Intronic
906534661 1:46544756-46544778 CACCTCAAGGCTGGGCGTGTGGG + Intergenic
906668926 1:47640891-47640913 CTCCTGAGGGCTTGGAGAGTAGG + Intergenic
907316081 1:53573483-53573505 CAACGTAGGTCTGGGAATGTGGG - Intronic
907442897 1:54489487-54489509 TACTTGAGTTCTGGGAATGTTGG - Intergenic
910224846 1:84925971-84925993 CACCTGAGCTCTGGAGGTGGAGG - Exonic
913612502 1:120521982-120522004 CACCTGTGGACTGGGCGTGGTGG - Intergenic
914331487 1:146674792-146674814 AATCTGAGATCTGGGAGAGTTGG + Intergenic
915159082 1:153903898-153903920 CACCTGAGTTCGGGAAGTGAAGG + Intronic
915482059 1:156193782-156193804 CACCTTGTGTTTGGGAGTGTTGG - Intergenic
915587299 1:156851221-156851243 CACCACTGTTCTGGGAGTGTTGG + Intronic
921157749 1:212451489-212451511 CACCTAAGGTCAGGGAGCATGGG + Intergenic
922196241 1:223363168-223363190 CTCCTGAAGTCTGGGTGTATGGG + Intronic
922662478 1:227442042-227442064 CACCTGGAGTGTGGGAATGTGGG - Intergenic
922731429 1:227950441-227950463 CACCTGAGGTCTGGCAGGGCTGG + Intergenic
1063048224 10:2415996-2416018 CCACTGAGATATGGGAGTGTGGG + Intergenic
1063717845 10:8546339-8546361 CTCCTGAGCTCTGGAAGTGCTGG + Intergenic
1063830034 10:9942178-9942200 GACCTGGGGTATGGGAATGTAGG + Intergenic
1065780701 10:29163969-29163991 CCCCTGAGGGCTGGGAGGGCTGG - Intergenic
1065875876 10:29996606-29996628 CACCTGAGTTCAGGGAATCTTGG - Intergenic
1066195407 10:33094424-33094446 CCCCTGAGGCCAGGCAGTGTGGG + Intergenic
1066758380 10:38732375-38732397 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
1067119706 10:43463646-43463668 CCCCAGAGCTCTGGGACTGTAGG + Intronic
1067302970 10:45031333-45031355 CAGCTGGGGGGTGGGAGTGTGGG - Intergenic
1067520545 10:46998861-46998883 CTCCTAAGGTCTGGGATTATAGG - Intronic
1069422610 10:68260653-68260675 CACCTGAGAGCTGGGGGTGAAGG + Intergenic
1070291356 10:75117297-75117319 CTCCTGAGTTCTGGGACTATAGG - Intronic
1070920615 10:80183323-80183345 CAAGTGAGGTCTGGGAGAGGAGG - Intronic
1070993442 10:80753572-80753594 CACCTGAGGTCAGGAACTGTTGG - Intergenic
1071098213 10:82003863-82003885 CACCTTAGAGCTGGGTGTGTTGG + Intronic
1074056070 10:109923614-109923636 AACCCCAGGTCCGGGAGTGTGGG - Intergenic
1075923878 10:126235293-126235315 AACCTCAGGCCTGGGTGTGTCGG + Intronic
1076125393 10:127970152-127970174 CAGCTGGAGTCTGGGAGTGTGGG - Intronic
1076266612 10:129113818-129113840 CAACTGAAGCCTGGGAGAGTTGG + Intergenic
1076643811 10:131937517-131937539 TCCATGAGATCTGGGAGTGTTGG + Intronic
1076697749 10:132255339-132255361 CACCTGAGGAGTGGGAGTGGGGG - Intronic
1076875403 10:133213326-133213348 CACCTGAGGGCTGGCTGTGGTGG - Intronic
1076932750 10:133544425-133544447 CCTCTTAGGTCTGGGAGTGTGGG + Intronic
1077048039 11:554834-554856 CACCTGAGAGCTGGAAATGTTGG - Exonic
1078737012 11:14029650-14029672 CACCTGAGCACTGGGAGAATGGG - Intronic
1079334025 11:19555430-19555452 CCCCCCAGGTCTGGGAGTGTTGG - Intronic
1080738155 11:35037627-35037649 CTCCTGAATTCTGGCAGTGTTGG + Intergenic
1081534307 11:43986208-43986230 CACCTGAAGGGTGGCAGTGTTGG - Intergenic
1083257282 11:61504445-61504467 CACCTGAGGTCAGGGGGTCGAGG - Intergenic
1083943738 11:65912507-65912529 CTCCTGAGTGCTGGGAGTATAGG + Intergenic
1084842923 11:71872181-71872203 AATCTGAAGACTGGGAGTGTGGG - Intronic
1085598996 11:77837721-77837743 TACCTGAGGGCTGGGCGTGGTGG - Intronic
1085759378 11:79228521-79228543 CACGTGAGGTCTGAGAAGGTGGG - Intronic
1086463831 11:87033568-87033590 TACCTAAGGTCAGGGAGTTTGGG + Intergenic
1087662457 11:101003289-101003311 CACCTGAGGTCAGGGATTCAAGG - Intergenic
1089155101 11:116395774-116395796 CAGCTGAGGGCTGGGCGTGGTGG + Intergenic
1090350677 11:126105869-126105891 TGCCTGGGGCCTGGGAGTGTGGG - Intergenic
1090767098 11:129885514-129885536 CACCTGAGGAGCGGGAGTGGCGG - Exonic
1091280224 11:134377576-134377598 CACCTGAGCTCCAGGTGTGTGGG + Intronic
1091787621 12:3252503-3252525 CCCCGGAGCTCTGGGAGTGCAGG - Intronic
1092356836 12:7802847-7802869 CACTTGAGGTCAGGGAGTCCAGG + Intergenic
1092896631 12:13018083-13018105 CTCCTGAGGGCTGGGAGGGAAGG + Intergenic
1095654690 12:44655202-44655224 CACCTGAGGACTGGGACGGTGGG - Intronic
1096867976 12:54576493-54576515 CACCTTAGCCCTGGGAGTGCAGG - Intronic
1097243100 12:57589836-57589858 CACCTGAGGTCAGGAGTTGTGGG - Intergenic
1097741544 12:63248997-63249019 CACCTGAGCTCTGGAAGTCAAGG - Intergenic
1098072390 12:66689825-66689847 TGCCAGAGGTCTGGGAGTGGGGG - Intronic
1100475539 12:94932052-94932074 CACCTGGGGGCTGGGCGTGGTGG + Intronic
1100656937 12:96656954-96656976 CACCTGAAGTCAGGCTGTGTAGG - Intronic
1103932359 12:124457497-124457519 CATCTCAGGGCTGGCAGTGTCGG - Intronic
1104677973 12:130728130-130728152 CTCCTGGGTTCTGGGACTGTGGG + Intergenic
1104858042 12:131910977-131910999 GACCTGAGGGCTGTGGGTGTTGG - Intronic
1107050867 13:36047801-36047823 TACCTGAGGGCTGGGTGTGGTGG + Intronic
1107597721 13:41980513-41980535 CATCTGAGGTATGGGTGTTTAGG - Intergenic
1107710436 13:43145634-43145656 CTCCTCAGGTCTGTGAGTGCAGG + Intergenic
1108431410 13:50357561-50357583 CAGCTGATGCCTAGGAGTGTGGG + Intronic
1116798968 14:49422914-49422936 CACCTGAGGTCAGGAGGAGTTGG + Intergenic
1116904375 14:50390916-50390938 CACCTGAGTTCTGGGAGTCAAGG - Intronic
1117404160 14:55385578-55385600 CATCTGATGGCTGGGAGTGGTGG - Intronic
1118310202 14:64686247-64686269 CACCTGAGGCCTGGGAGGCCTGG - Intergenic
1118383692 14:65238182-65238204 CACCTGCGGGAAGGGAGTGTGGG - Intergenic
1119432270 14:74576065-74576087 CCCCTGAGGGCAGGGAGAGTGGG - Intronic
1119661902 14:76458176-76458198 CAGCTGAGGTGTGGCAGTTTTGG - Intronic
1121021997 14:90585888-90585910 GACCTGATGTATGGGAGTGTTGG - Intronic
1121538565 14:94708072-94708094 CACCTGAGGTCAGGGATTCAAGG + Intergenic
1121600286 14:95198420-95198442 AAGGTGAGGTCTGGGAGTCTTGG - Intronic
1121794739 14:96725517-96725539 CACCTGTGGGCTGGGAAGGTGGG - Intergenic
1123441786 15:20297091-20297113 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
1123777663 15:23596856-23596878 CACCTGAGCACTGGGAGGGCGGG - Intronic
1127666180 15:61149193-61149215 CACAATAGGTCTGGGATTGTTGG - Intronic
1130485929 15:84398561-84398583 TACCTCAGGTCTGAGAGTCTGGG - Intergenic
1132325871 15:100969646-100969668 CACCTGTGGTGAGGGAGGGTGGG - Intronic
1132949031 16:2549991-2550013 CATGGGAGGGCTGGGAGTGTGGG + Intronic
1132965557 16:2652136-2652158 CATGGGAGGGCTGGGAGTGTGGG - Intergenic
1133085455 16:3358859-3358881 CATCTGATGTCTGGGACTTTTGG - Intergenic
1136547827 16:30965488-30965510 CACCTGGGCTCTGGGAGTCAGGG + Intronic
1136719420 16:32308420-32308442 CACTTGAGGTCAAGGAGTTTGGG + Intergenic
1136724446 16:32346820-32346842 CACTTGAGGTCAAGGAGTTTGGG + Intergenic
1136837792 16:33514700-33514722 CACTTGAGGTCAAGGAGTTTGGG + Intergenic
1136842772 16:33552861-33552883 CACTTGAGGTCAAGGAGTTTGGG + Intergenic
1138451882 16:57098070-57098092 AACCTGGGGCCTGGGAGGGTGGG + Intronic
1139437972 16:66947857-66947879 CAACAGAGGCCTGGGAGTGCCGG + Intergenic
1140002067 16:71036108-71036130 AATCTGAGATCTGGGAGAGTTGG - Intronic
1140359180 16:74330349-74330371 CACGTGAGGTGTTGGAGTTTGGG + Intergenic
1141843289 16:86588860-86588882 AACCAGAGGGCTGGGAGTGCTGG - Intergenic
1142066175 16:88064328-88064350 CACCTGTGGTCAGGGACAGTGGG + Intronic
1203001984 16_KI270728v1_random:170935-170957 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
1203007011 16_KI270728v1_random:209349-209371 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
1203133588 16_KI270728v1_random:1707341-1707363 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
1203147972 16_KI270728v1_random:1814986-1815008 CACTTGAGGTCAAGGAGTTTGGG + Intergenic
1203152937 16_KI270728v1_random:1853159-1853181 CACTTGAGGTCAAGGAGTTTGGG + Intergenic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1143566849 17:7727301-7727323 CACCTTTGATCTGGGAATGTAGG - Intronic
1144637696 17:16920778-16920800 CCCCTGAGCCCAGGGAGTGTGGG + Intergenic
1144890163 17:18489823-18489845 CCCCAGAGGGCTGGGACTGTGGG + Intronic
1145142053 17:20454494-20454516 CCCCAGAGGGCTGGGACTGTGGG - Intronic
1146179526 17:30688436-30688458 CACATGAGGTCTGGCACTGGTGG - Intergenic
1146787850 17:35734074-35734096 CACCTGAGGTCAGGGATTCCAGG + Intronic
1146936380 17:36814940-36814962 CACGTATGGCCTGGGAGTGTTGG + Intergenic
1147007042 17:37411715-37411737 CACCTGAAGGCCGGGAGTGGTGG - Intronic
1147547768 17:41416197-41416219 CAGCTGGCGTCTAGGAGTGTTGG - Intergenic
1147865008 17:43546182-43546204 CACCTGAGGCCGGGGCGTCTGGG + Exonic
1148192319 17:45688193-45688215 CACCTGTGGAATGAGAGTGTTGG - Intergenic
1148438510 17:47699743-47699765 CCCCTGAGGGCTGGGAGGGGAGG - Intronic
1148601118 17:48895047-48895069 CACCTGAGCTCTGAAACTGTTGG - Intronic
1149598952 17:57880994-57881016 CACCTGAGGTCTGGGGGCTCTGG - Intronic
1150753527 17:67889042-67889064 CACCTGAGGACTAGGACTATTGG - Intronic
1151456811 17:74231404-74231426 CAACTGAGGGCTGGGCGTGGTGG + Intronic
1152073339 17:78144852-78144874 CACCGGAGGCCTGGGTGTGTTGG - Intergenic
1152456755 17:80421416-80421438 CACATCAGGTCTGGGAGTTGGGG + Intronic
1152809777 17:82375930-82375952 CATCTGAGGTGTGGGAGGATCGG + Intergenic
1152841297 17:82570407-82570429 CACCTGAGCCCTGGGAGTTCAGG + Intronic
1153821986 18:8839816-8839838 CAACTGAGGTCTCTGAGTGTGGG + Intergenic
1157415121 18:47495935-47495957 CACCTGAGCTCAGGGAGTCGAGG + Intergenic
1157445682 18:47745329-47745351 CCCCTGACATCTGGGAGTGAAGG + Intergenic
1158274177 18:55748506-55748528 CTCCTCATGCCTGGGAGTGTTGG - Intergenic
1160807582 19:999315-999337 CAACTCAGCTCTGGGAGGGTTGG - Intergenic
1160904822 19:1447126-1447148 CACCGGAGGTGGGGGAGGGTGGG - Intronic
1161749389 19:6083654-6083676 CACTTGAGCTCTGGAAGTGGAGG - Intronic
1162437774 19:10672738-10672760 CACCTGAGCCCTGGAAGTGGAGG - Intronic
1162451888 19:10759982-10760004 CAGCTGAGGGCTTGCAGTGTGGG - Intronic
1162460351 19:10810866-10810888 CACCAAAGGTCTGGCAGTCTGGG - Intronic
1162979094 19:14227120-14227142 CACCTGAGGTCTGGCACTGGTGG + Intergenic
1163020966 19:14480550-14480572 CCCCGGAGGCCTGGGAGTGAGGG - Intronic
1163628119 19:18402388-18402410 ATCCAGAGGTCTGGGAGTCTTGG + Intergenic
1163628290 19:18403517-18403539 ATCCAGAGGTCTGGGAGTCTTGG + Intergenic
1163628324 19:18403613-18403635 ATCCAGAGGTCTGGGAGTCTTGG + Intergenic
1163628358 19:18403701-18403723 GTCCTGAGGTCTGGGGGTCTTGG + Intergenic
1163628374 19:18403749-18403771 ATCCAGAGGTCTGGGAGTCTTGG + Intergenic
1164129353 19:22347925-22347947 CACCTGAGGGCTGGGTGTGGTGG - Intergenic
1164804090 19:31102792-31102814 CATGTGAGCTCTGGGAGGGTGGG - Intergenic
1165096658 19:33413396-33413418 CACCTCAGCTCCGGGAGTCTTGG + Intronic
1168391505 19:56011908-56011930 CACCTGAGGTCAGGAATTCTAGG - Intronic
926079923 2:9976694-9976716 CACATGAGGTCTTGGGGTGCTGG + Intronic
926312785 2:11686506-11686528 CACCTGAGGCCTGTGTGTATTGG + Intronic
928077925 2:28282027-28282049 CAGCTGAGCTTTGGGAGTGAGGG + Intronic
928161387 2:28928960-28928982 CAACTGTGGTCTGGGTGTGGTGG - Intronic
929493568 2:42419538-42419560 CATCTGAGGGCTGGGCGTGGTGG - Intronic
929759636 2:44796460-44796482 CACCTTAGGGCTGGGCGTGTTGG + Intergenic
932732368 2:74230458-74230480 CACCTGAGCTCAGGAAGTCTGGG - Intronic
934321696 2:91976816-91976838 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
935573035 2:104682090-104682112 TAACTGAAGTCTGGGAGTATGGG + Intergenic
935736926 2:106113718-106113740 CACCTGAGGGCAGGGAGCCTGGG + Intronic
936895630 2:117424307-117424329 CACCTGAGCTCTGGAAGTCGAGG + Intergenic
939869451 2:147510682-147510704 CACTTGAGGCCTGGAAATGTTGG + Intergenic
946682311 2:222230090-222230112 CACCTGAGCTCAGGAGGTGTAGG + Intronic
947549378 2:231035912-231035934 CACCTGAGGTCGGGGATTGGAGG - Intergenic
948661019 2:239506431-239506453 CACTCTAGGTCTGGGACTGTGGG - Intergenic
948678352 2:239612233-239612255 CCCCTGGGGTCTGGGACTGAGGG - Intergenic
1170581527 20:17703051-17703073 CACAGGAGGTCTGGGAGTGAAGG - Intronic
1173856971 20:46256579-46256601 CAGATGAGGTCAGAGAGTGTGGG + Intronic
1174562835 20:51443648-51443670 CACCTTGGGTCTGGGACTCTGGG + Intronic
1175608271 20:60329182-60329204 CACCTGGGGTCTGGGTCTTTTGG - Intergenic
1176296619 21:5076584-5076606 CACCTGGGGTCTGGCAGGGAGGG + Intergenic
1177414396 21:20775866-20775888 CACCTGTGCACTGGGAGAGTGGG - Intergenic
1179619647 21:42604921-42604943 CACTTGAGGGCTGGGCGTGGTGG + Intergenic
1179860430 21:44185537-44185559 CACCTGGGGTCTGGCAGGGAGGG - Intergenic
1180151835 21:45952221-45952243 CACCCGATGTCTGTGAGTGACGG + Intergenic
1180309961 22:11160773-11160795 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
1180548440 22:16522583-16522605 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
1180720972 22:17908188-17908210 CAGCTGGGGTCTGGCTGTGTGGG - Intronic
1180749540 22:18114726-18114748 CACAGGTGGTCAGGGAGTGTGGG + Intronic
1180995744 22:19964427-19964449 CACCTGAGGTCTGGGAGTGTGGG + Intronic
1182062770 22:27409738-27409760 CTCCAAAGGTCTGGGTGTGTTGG + Intergenic
1182211013 22:28677716-28677738 CACTTGAGGTCAAGGAGTTTGGG + Intronic
1183101189 22:35585313-35585335 CATCTGAGGTCAGGGAGAGGAGG + Intergenic
1183102204 22:35591022-35591044 CTGCTGGGGGCTGGGAGTGTGGG - Intergenic
1183465169 22:37976422-37976444 CCCCTGAGGCCAGGGACTGTAGG + Intronic
1183605219 22:38863940-38863962 AAGCTGAGGTTTGGGAGGGTGGG - Exonic
1184120703 22:42448108-42448130 CACAGGAGTTCTGGGAGTGACGG - Intergenic
1184132468 22:42525296-42525318 CACGGGAGTTCTGGGAGTGACGG - Intergenic
1184212448 22:43043921-43043943 CACCAGAGGTCAGGGAGTTGGGG - Intronic
1184254406 22:43278897-43278919 CACCTGAGCTGCGGGAGGGTGGG + Intronic
1184467812 22:44679105-44679127 CTCCTGAGGCCTAGGAGAGTGGG - Intronic
1185194264 22:49458933-49458955 AGCCTGGGGTCAGGGAGTGTAGG - Intronic
949947370 3:9201253-9201275 CACCTGAGGTCTTGGGGGCTGGG - Intronic
953343818 3:42158654-42158676 AACCAGAGGTCTGGGCGTGGTGG + Intronic
953680410 3:45034823-45034845 CTCCTGAGGGCTGGTAGGGTGGG - Intronic
954403173 3:50330058-50330080 ACCCTGAGGTCAGGGAGTGCTGG - Exonic
954569860 3:51631719-51631741 CACCTGAGCCCAGGGAGTGAAGG - Intronic
954775292 3:53011741-53011763 GAACTGAGGTTTGGGAGTGAGGG + Intronic
956454268 3:69405459-69405481 ATCCTGTGGTCTGGGAGGGTGGG + Intronic
956603164 3:71045007-71045029 CACTTGAGGTGAGGGAGTGGGGG + Intronic
956982984 3:74661564-74661586 CAACTGAGGGCTGGAAATGTAGG - Intergenic
957895441 3:86415819-86415841 AACAAGAGGTCTGGGATTGTGGG + Intergenic
959516778 3:107276059-107276081 CACCTGAGCTCAGGAGGTGTGGG + Intergenic
961481768 3:127184999-127185021 TACCTGAGGCCTGGGAGTCAGGG - Intergenic
961561342 3:127732564-127732586 GCCCTGGGGTCTGGGCGTGTAGG - Intronic
961628995 3:128282691-128282713 CACCTGAAGTCTGTCAGTGCTGG - Intronic
961992368 3:131205616-131205638 CTCTTGAGGGCTGGGGGTGTGGG - Intronic
965435262 3:168642677-168642699 TACCTGAGGCCTGGGATTGTGGG - Intergenic
966302931 3:178498805-178498827 CACTGGAAGTCTGGGATTGTTGG - Intronic
967122917 3:186399578-186399600 CCCCTGGGGGCTGGGAGGGTGGG + Intergenic
967323487 3:188216723-188216745 CACCTGCCTTGTGGGAGTGTTGG - Intronic
967991720 3:195136447-195136469 CCCCTGAGGTCCTGGAGTGATGG - Intronic
968129159 3:196182482-196182504 CACCTGAGCTCTGGAAGTTGAGG - Intergenic
968188343 3:196649278-196649300 CACCTGGGATCTGGGAGAATGGG - Intronic
969784014 4:9438235-9438257 AATCTGAAGACTGGGAGTGTGGG - Intergenic
970601480 4:17643815-17643837 CTGCTGAGGGCTGGGAGTGGGGG + Intronic
971648393 4:29238206-29238228 CACCTGAGGTCAGGAAGTCGAGG + Intergenic
976240735 4:82953824-82953846 CACCTCAGGGCTAGGACTGTAGG - Intronic
977823424 4:101502578-101502600 CACCTGAGCCCTGGGAGACTGGG + Intronic
982037085 4:151356237-151356259 CCCCTGTGGTCAGGGAGTCTGGG + Intergenic
985338360 4:188920636-188920658 CTCCTTAGGTCTGGGAGCCTAGG + Intergenic
985655292 5:1128559-1128581 CCCCAGAGGTCTCAGAGTGTTGG - Intergenic
986901366 5:12438087-12438109 CACCTGAGGCCTGGGACTTAGGG + Intergenic
988942525 5:36160658-36160680 CAGCAGAGGTCTGAGAGAGTTGG + Intronic
990430160 5:55726563-55726585 CACCTGAGCCCAGGGAGTTTGGG + Intronic
991484825 5:67124104-67124126 GAACTGAGGTGTGGGAGGGTGGG - Intronic
991540869 5:67726721-67726743 AGCCAGAGGTCTGTGAGTGTTGG - Intergenic
998464223 5:142330361-142330383 CACCTGAGCTCGGGAAGTCTAGG + Intergenic
999685362 5:154097917-154097939 CCTCTGAGCTCTGGGAGTGAAGG - Intronic
1000369732 5:160523209-160523231 CACCTCAGGGCTGGGTGTGGTGG - Intergenic
1001453364 5:171842940-171842962 CAACTGAGGAGTGGGGGTGTGGG - Intergenic
1001982883 5:176048309-176048331 CACCTGAGGCCTGGGTGTTTAGG + Intergenic
1002234580 5:177795748-177795770 CACCTGAGGCCTGGGTGTTTAGG - Intergenic
1003011215 6:2429054-2429076 CACCTGAGGTCAGGGAGTAGAGG + Intergenic
1003342457 6:5234923-5234945 AACCTGAGCTCTGGGGGTTTGGG - Intronic
1004143762 6:13045962-13045984 GTCCTGTGGTCTGGGAGTGGTGG - Intronic
1004467037 6:15895560-15895582 CAGCTGAGGTCTGGCAGAGCTGG + Intergenic
1005522431 6:26612869-26612891 CATCTGAGCTCTGGGAATGGAGG + Intergenic
1006765210 6:36499004-36499026 CACTTTGGGTCTGGGAGTTTGGG - Intronic
1007094178 6:39203328-39203350 CACCTGATGGCTGGGAGTCAGGG + Intronic
1007663781 6:43502665-43502687 CAGCTGAGATCTGGGATTGTGGG + Intronic
1008079449 6:47179060-47179082 CACCTGAGGTAGGAGAGTGAGGG + Intergenic
1009611965 6:65956471-65956493 CACCTGAGTCCTGAAAGTGTTGG - Intergenic
1009741916 6:67757891-67757913 GACCTGAAGTCTGTGACTGTGGG - Intergenic
1011351388 6:86427555-86427577 CACCTGAGTTCAGGGAGTCGAGG - Intergenic
1015445041 6:133293851-133293873 CACCTGAGCCCTGGAAGTGGAGG + Intronic
1015634288 6:135260872-135260894 CACCTGAGGTCCGGAAGTTAAGG - Intergenic
1016103823 6:140137258-140137280 CACCTGAGGTCAGTGAGCTTGGG + Intergenic
1017564574 6:155669858-155669880 CACCTGAGGTCTGCGAGTTCTGG - Intergenic
1017608723 6:156161906-156161928 CACCCAAGGTCTTGGAGTTTAGG - Intergenic
1018176905 6:161184962-161184984 CTCCTGTGCTCTGGGTGTGTGGG - Intronic
1019723427 7:2587235-2587257 CACGGGAGGTCTGAGTGTGTGGG + Intronic
1020871040 7:13629047-13629069 CACCTGAGGTCTTGGAAAGCAGG + Intergenic
1021249588 7:18307582-18307604 CACCTGAGGTCAGGAGTTGTGGG + Intronic
1021862143 7:24916560-24916582 AATCTGAGGTTGGGGAGTGTTGG - Intronic
1022000242 7:26219210-26219232 CACCTGAGTGCTGGGATTATAGG + Intergenic
1022045094 7:26616486-26616508 CACCTCAGGTCAGGGAGGCTGGG + Intergenic
1022166220 7:27765475-27765497 CTACTGAGGACTGGGAGTGGGGG - Intronic
1022426761 7:30276661-30276683 CTCCTGAGCCCTGGTAGTGTAGG - Intergenic
1023364628 7:39451538-39451560 CCACTGACGTCTGGGAGGGTTGG - Exonic
1024571095 7:50723471-50723493 CAGCTGAGGTCTGGAAATGAAGG + Intronic
1024586346 7:50845110-50845132 CACCTGAGGTCAGGTGTTGTGGG + Intergenic
1024662071 7:51506298-51506320 TACCAGAGACCTGGGAGTGTAGG - Intergenic
1024695100 7:51847754-51847776 CACCTGAGGATGGGGAGTGTGGG - Intergenic
1024760585 7:52592226-52592248 TACCTCAGGTTTGGGAGTTTGGG - Intergenic
1028291123 7:89066108-89066130 TACCTAAGGTTTGGTAGTGTTGG + Intronic
1028581527 7:92414080-92414102 CACAAAAGGTCTGAGAGTGTAGG + Intergenic
1029546356 7:101212423-101212445 CACCTGAGGGATGGGGGTGCAGG + Intronic
1030015767 7:105219154-105219176 CACTGGAGGTGTGGGAGTGTGGG - Intronic
1031701227 7:124929571-124929593 CACCTGAGCTCTGTGAGGGCGGG + Intronic
1032013299 7:128360529-128360551 CCCCTGGGGTCTGAGAGTGAGGG - Intronic
1032550404 7:132779307-132779329 CACCTGAGGGTGAGGAGTGTGGG + Intergenic
1032802856 7:135330359-135330381 CACCTGAGGACTGGGACTCAGGG + Intergenic
1033128600 7:138726326-138726348 GACCTGAGATGTGGGAGTATGGG + Intronic
1033534727 7:142301156-142301178 GACCTGATGGCTGGGAGTCTGGG - Intergenic
1034968914 7:155407545-155407567 AATGTGAGGTGTGGGAGTGTGGG + Intergenic
1035104882 7:156434155-156434177 CAACTGAGGTCTGGGAGGAGAGG + Intergenic
1036169425 8:6468369-6468391 AGCCTGCGGTCTGGGTGTGTGGG - Intronic
1036217686 8:6894327-6894349 CATCTGAGGTCTAGTAGAGTTGG + Intergenic
1036288251 8:7463368-7463390 CATCTGAGGTATGGGAGTCCAGG - Intronic
1036333224 8:7848160-7848182 CATCTGAGGTATGGGAGTCCAGG + Intronic
1036770721 8:11576813-11576835 CACCTGAAGTCTGAGATTTTGGG + Intergenic
1036835027 8:12055893-12055915 AATCTGAAGACTGGGAGTGTGGG + Intergenic
1036856870 8:12302457-12302479 AATCTGAAGACTGGGAGTGTGGG + Intergenic
1037463416 8:19136022-19136044 CCCCTCAGGGCTGGGAGTGGTGG + Intergenic
1037517785 8:19650855-19650877 CACCTGAGTCCTGGAAGTGCAGG - Intronic
1038595798 8:28884937-28884959 CACCTTGGATCTGAGAGTGTTGG - Intronic
1039439213 8:37583300-37583322 TACCAGAGGCCTGGGAGTGTGGG - Intergenic
1041692217 8:60699723-60699745 CACGTGAAGTCTGGGAGCATGGG - Intronic
1042226823 8:66520846-66520868 CACCTGAGGGCTGGGTGTGGTGG - Intergenic
1042711542 8:71722793-71722815 CAACTGTGGTCTGTGAATGTGGG - Intergenic
1044971880 8:97627876-97627898 CACCTGAGGTCCCAAAGTGTTGG - Intergenic
1045425755 8:102064307-102064329 CCCCTGAGCCCTGGCAGTGTTGG - Intronic
1045498636 8:102728721-102728743 CACATGGGGTCTGGGAGTCTGGG + Intergenic
1046521383 8:115330753-115330775 CACCCGTGGGCTGGCAGTGTTGG + Intergenic
1047999093 8:130362226-130362248 AACCAGAGGTGGGGGAGTGTGGG + Intronic
1049745667 8:144262238-144262260 GACCCGAGATCTGGGAGTGCTGG - Exonic
1050254008 9:3775108-3775130 CAAGTGAGGTCTGGGTGTGGAGG + Intergenic
1051429282 9:16965541-16965563 CACCTGAGTGCTGGGATTATAGG + Intergenic
1052081460 9:24210937-24210959 CAAGTTAGGTCTGGGTGTGTCGG + Intergenic
1053472676 9:38358096-38358118 CACCTGGGCTCTGGGATTGTTGG + Intergenic
1057220543 9:93255429-93255451 CACCTGAAGCCAGGGAGTGGAGG - Intronic
1058583668 9:106484700-106484722 CACCTGATTTCTGTCAGTGTAGG - Intergenic
1060149916 9:121282011-121282033 CACCTGAGGTGTGTGAGTCATGG + Intronic
1186494154 X:9998612-9998634 CACCTGAGGTCAGGGATTCGAGG + Intergenic
1188880076 X:35481703-35481725 CACTTGAGGGCTGGGAGTGGTGG + Intergenic
1188977469 X:36692134-36692156 CTCCTGAGGTCTGCAGGTGTTGG + Intergenic
1189390127 X:40569585-40569607 CATCTGGGGGCTGGAAGTGTTGG - Intergenic
1190256244 X:48764867-48764889 CACCTGTGGTCTGGCACTATAGG - Intronic
1197900638 X:131367961-131367983 CACCTGAGGTCAGGGATTCGAGG + Intronic
1201189185 Y:11431939-11431961 CACTTGAGGTCAAGGAGTTTGGG - Intergenic
1202368461 Y:24182420-24182442 TACCTCAGGTCTGAGAGTCTGGG - Intergenic
1202502324 Y:25487697-25487719 TACCTCAGGTCTGAGAGTCTGGG + Intergenic