ID: 1180996022

View in Genome Browser
Species Human (GRCh38)
Location 22:19965746-19965768
Sequence CAGTGCCTCCTCGTGAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 140}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180996022_1180996027 0 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996027 22:19965769-19965791 AACCCTGGCCGTGGAGAGGGAGG No data
1180996022_1180996026 -3 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996026 22:19965766-19965788 CTGAACCCTGGCCGTGGAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 291
1180996022_1180996035 20 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996035 22:19965789-19965811 AGGACCTGTAGTGGCCAAGGGGG 0: 1
1: 0
2: 0
3: 19
4: 432
1180996022_1180996024 -9 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996024 22:19965760-19965782 GAGGCACTGAACCCTGGCCGTGG 0: 1
1: 0
2: 1
3: 19
4: 314
1180996022_1180996031 11 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996031 22:19965780-19965802 TGGAGAGGGAGGACCTGTAGTGG 0: 1
1: 0
2: 1
3: 32
4: 323
1180996022_1180996034 19 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996034 22:19965788-19965810 GAGGACCTGTAGTGGCCAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 141
1180996022_1180996038 24 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996038 22:19965793-19965815 CCTGTAGTGGCCAAGGGGGTGGG 0: 1
1: 0
2: 1
3: 16
4: 237
1180996022_1180996025 -4 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996025 22:19965765-19965787 ACTGAACCCTGGCCGTGGAGAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1180996022_1180996032 17 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996032 22:19965786-19965808 GGGAGGACCTGTAGTGGCCAAGG 0: 1
1: 0
2: 0
3: 18
4: 236
1180996022_1180996036 23 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996036 22:19965792-19965814 ACCTGTAGTGGCCAAGGGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 193
1180996022_1180996033 18 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996033 22:19965787-19965809 GGAGGACCTGTAGTGGCCAAGGG No data
1180996022_1180996039 30 Left 1180996022 22:19965746-19965768 CCTGAACTCACGAGGAGGCACTG 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1180996039 22:19965799-19965821 GTGGCCAAGGGGGTGGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180996022 Original CRISPR CAGTGCCTCCTCGTGAGTTC AGG (reversed) Intronic
901157974 1:7153496-7153518 CAGAGCCTCCTTCTGAGTGCAGG - Intronic
903632741 1:24788797-24788819 CAGTGCCTGCTAGTGTGTCCAGG - Intronic
905056162 1:35095841-35095863 CAGTTCATTCTCCTGAGTTCTGG - Exonic
905507207 1:38489435-38489457 GAGTGCTTCCACCTGAGTTCAGG - Intergenic
907036265 1:51219046-51219068 GAGTGCCTCCTCTTGAGTCTGGG - Intergenic
907177781 1:52541122-52541144 CTCTGCCTCCTCCTGGGTTCAGG - Intronic
908173325 1:61529313-61529335 GAGTGCCTCCCCGTGAGTTCCGG + Intergenic
910200696 1:84695548-84695570 TAGTGACTCCTCATGAGATCTGG - Intergenic
911470300 1:98309799-98309821 CATTGCCTCTTAGTGAATTCAGG + Intergenic
911502512 1:98705825-98705847 CACTGCCACCTCTTCAGTTCAGG - Intronic
912470665 1:109904758-109904780 CAGTGACTCCGAGAGAGTTCTGG + Intergenic
913175382 1:116268283-116268305 CAGAGCCACCTCTTGGGTTCTGG - Intergenic
913972152 1:143423640-143423662 CAGTGCTTCCTCCTGAGTGAGGG - Intergenic
914066533 1:144249253-144249275 CAGTGCTTCCTCCTGAGTGAGGG - Intergenic
914112620 1:144717101-144717123 CAGTGCTTCCTCCTGAGTGAGGG + Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1063071979 10:2675899-2675921 CAGTGAGTTCTCGTGAGATCTGG + Intergenic
1063930849 10:11027227-11027249 CATTGCCTCCTCGTGCATTTGGG + Intronic
1064250956 10:13706033-13706055 CAGTCCCTCCCCATGAGCTCTGG - Intronic
1069701874 10:70432793-70432815 CAGCCCCTCCTCTTCAGTTCTGG + Exonic
1071859124 10:89654838-89654860 CAGTGAGTTCTCGTGAGATCTGG - Intergenic
1076781002 10:132724574-132724596 TGGGGCCTCCTTGTGAGTTCTGG - Intronic
1076781065 10:132724865-132724887 TGGGGCCTCCCCGTGAGTTCTGG - Intronic
1076805905 10:132858620-132858642 CAGGGCCACCTCCTGAGGTCAGG + Intronic
1076853045 10:133102521-133102543 CAGCGTCTCCCTGTGAGTTCTGG + Intronic
1077307709 11:1875393-1875415 CAGTGCTTCCTCCTGAGTGAGGG + Intronic
1084434027 11:69127536-69127558 CTGTGCCTCCTCCTGGGTGCTGG - Intergenic
1084861340 11:72020274-72020296 CAGAGCCTGCTCCTGAATTCTGG + Intronic
1086999498 11:93400315-93400337 CATTGCCTCTTCCTGAATTCTGG + Intronic
1088990773 11:114951529-114951551 AAGTGCCTCCCCTTGACTTCAGG - Intergenic
1089972579 11:122705948-122705970 CAGTGCCTCCGTGTGACTTGTGG - Intronic
1102774821 12:115509235-115509257 CTGTGGCACCTGGTGAGTTCAGG + Intergenic
1105533133 13:21237863-21237885 CAGTGAGTTCTCATGAGTTCTGG + Intergenic
1113356076 13:109581522-109581544 CAGTGAGTCCTCATGAGATCTGG - Intergenic
1117150588 14:52883798-52883820 CAGTGACTTCTCATGAGATCTGG + Intronic
1118818587 14:69329806-69329828 AAGTGACTTCTCGTGAGATCTGG - Intronic
1121050912 14:90818350-90818372 CAGTGCCTCCTTGTGACTGCGGG - Intergenic
1202837486 14_GL000009v2_random:89230-89252 GAGTGACTTCTCGTGAGATCTGG + Intergenic
1126506219 15:49406928-49406950 CAGGGCATCCTCGGGTGTTCTGG - Intronic
1129920551 15:79315928-79315950 CAGTGCCTCCTCAAGACTCCTGG - Intronic
1130910609 15:88268315-88268337 GAGTGCCTCCTGCTGAGCTCAGG + Intergenic
1131438490 15:92441255-92441277 TAGTGCCTCCTAGGGAGTCCAGG + Intronic
1135981070 16:27147743-27147765 CAGTGAGTTCTCGTGAGATCTGG + Intergenic
1138584391 16:57960719-57960741 CATCGCCCCCTCATGAGTTCTGG + Intronic
1140270452 16:73460778-73460800 CAGTGAGTTCTCGTGAGATCTGG + Intergenic
1142591781 17:1009523-1009545 CAGTCCCTCCTCGTGGGCGCTGG - Intronic
1145002024 17:19312317-19312339 AAGTGTCTCCTGGTTAGTTCAGG - Intronic
1146689036 17:34860388-34860410 CAGTGCCCCCTCTTGAGAGCTGG - Intergenic
1147612940 17:41812215-41812237 CAGTGCCCCCGCCTGAGATCAGG + Intronic
1149526514 17:57360082-57360104 CAGTGCCTCCTCGCCTGCTCTGG - Intronic
1149548403 17:57521565-57521587 GAGTGCCTGCTCCTGACTTCTGG + Intronic
1155672065 18:28383771-28383793 CAGTGAGTCCTCCTGAGATCTGG + Intergenic
1157325311 18:46664626-46664648 CAGTGCTTCCTCCTGACTCCAGG - Intergenic
1158631590 18:59119885-59119907 CAGTCCCTCCTTGTGAGTTATGG + Intergenic
1160043699 18:75368036-75368058 CAGGGGCTCCTGGGGAGTTCGGG + Intergenic
1160525766 18:79534627-79534649 AAGTGCCTCCTCTTGGCTTCTGG + Intergenic
1161822200 19:6536660-6536682 CGTTGCCTCCTCCTAAGTTCTGG + Intergenic
1164536969 19:29093189-29093211 CGGGGCATCCTCGTCAGTTCAGG - Intergenic
1164536991 19:29093279-29093301 CGGGGCATCCTCGTCAGTTCAGG - Intergenic
1164537013 19:29093365-29093387 CGGGGCCTCCTGGTCAGTTCAGG - Intergenic
1164537025 19:29093433-29093455 CGGTGCGTCCTGGTCAGTTCAGG - Intergenic
1165008498 19:32825406-32825428 CACTGGCTCCTCGTGCGTGCTGG + Intronic
1166490828 19:43258991-43259013 CAGAGCCTCCCCGTCAGTCCCGG - Exonic
1167685450 19:50953025-50953047 CACTGCCTCCTCCTGGGCTCTGG + Exonic
1168427919 19:56253780-56253802 CAGTGTCTCTTCGTCAATTCAGG + Intronic
1202635156 1_KI270706v1_random:38121-38143 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1202650062 1_KI270706v1_random:171984-172006 GAGTGACTTCTCGTGAGATCTGG + Intergenic
929031943 2:37657521-37657543 CAGAGCCTCCTCTTGAGCTGGGG + Intronic
934287156 2:91658937-91658959 CAGTGCTTCCTCCTGAGTGAGGG - Intergenic
936018575 2:108977664-108977686 CAGTGACTCCTAGTGAGAGCCGG - Intronic
946333908 2:219025195-219025217 CAGTTCCTCCTGGTGGGTTGTGG - Intronic
946463990 2:219895277-219895299 CAGTGCTTCCTTGTGGGTTATGG + Intergenic
1168770889 20:415911-415933 TAGTGAGTCCTCGTGAGATCTGG - Intronic
1172330269 20:34071039-34071061 GAGTGACTGCTCGTGAGATCTGG - Intronic
1176147699 20:63572776-63572798 CAGGGCCTCCTCGCGACTGCGGG + Intronic
1176387164 21:6143975-6143997 CAGTGAGTTCTCGTGAGATCTGG + Intergenic
1176601751 21:8800567-8800589 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1176647370 21:9363885-9363907 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1179736309 21:43394277-43394299 CAGTGAGTTCTCGTGAGATCTGG - Intergenic
1180089473 21:45526419-45526441 CAGGGCCTCACCCTGAGTTCTGG + Intronic
1180344037 22:11692118-11692140 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1180365549 22:11935106-11935128 GAGTGGCTTCTCGTGAGATCTGG + Intergenic
1180996022 22:19965746-19965768 CAGTGCCTCCTCGTGAGTTCAGG - Intronic
1183155176 22:36069413-36069435 GGGAGCCTCCTAGTGAGTTCTGG - Intergenic
1184756714 22:46520243-46520265 CAGGGCCTCCTTCTGAGCTCGGG - Intronic
1185138271 22:49086157-49086179 GAGTGCGTTCTCGTGAGATCTGG + Intergenic
949946174 3:9191837-9191859 CAGTGAGTTCTTGTGAGTTCTGG + Intronic
950307888 3:11930316-11930338 CAGGGCTTCTTCGGGAGTTCTGG + Intergenic
950705982 3:14782072-14782094 CAGTGAGTTCTCGTGAGATCTGG + Intergenic
952624150 3:35383466-35383488 CAGTGCCAGCACGTGAATTCAGG - Intergenic
953917425 3:46929534-46929556 CAGTGACTGCTGGTGAGTGCAGG - Intronic
954748173 3:52798762-52798784 CAGTGCCTTCCAGTGAGTCCTGG + Intronic
954904962 3:54053464-54053486 CCTTGGCTCCTGGTGAGTTCAGG + Intergenic
960056986 3:113282925-113282947 CTGTGTGTCCTCGTGAGTCCGGG + Intronic
960379259 3:116939490-116939512 CAGTGGCTCCTTGGGAGTTACGG - Intronic
961181094 3:124878190-124878212 CAGAGCCTCATCATGAGCTCTGG + Intronic
962257757 3:133884056-133884078 CAGTGCCAGGTTGTGAGTTCAGG - Intronic
967692559 3:192493748-192493770 CAGTGACTTCTCCTGAGATCTGG - Intronic
968471465 4:784553-784575 CTGTCCCTCCTCCTGAGTCCTGG - Intergenic
973365078 4:49202374-49202396 GAGTGACTTCTCGTGAGATCTGG - Intergenic
973392431 4:49567632-49567654 TAGTGAGTCCTCGTGAGATCTGG + Intergenic
976285870 4:83370640-83370662 CAGAGCCTCCTGGGGAGGTCAGG - Intergenic
979324927 4:119368096-119368118 CTCTGCCTCCTCCTGGGTTCAGG + Intergenic
980793923 4:137656547-137656569 AAGTGCCTCCTCACGAGGTCAGG - Intergenic
981930154 4:150180945-150180967 CAGTCCCTCCTCCTGGGTTTGGG - Intronic
983242833 4:165253114-165253136 CTCTGCCTCCTCCTGGGTTCAGG + Intronic
985520432 5:371652-371674 CAGAGCCACCTTGTGAGTCCAGG - Intronic
985657017 5:1137558-1137580 CAGTGCCTGCTCGGGGGGTCTGG - Intergenic
986301107 5:6479060-6479082 CAGTGCCTCATCCTGAAATCAGG + Intronic
987664066 5:20913311-20913333 CAGTGCCCACTAGTGAATTCAGG + Intergenic
988758621 5:34288880-34288902 CAGTGCCCACTAGTGAATTCAGG - Intergenic
1000337592 5:160253348-160253370 CAAGGCTTCCTCGTGAGGTCTGG + Exonic
1000692209 5:164337836-164337858 CAGTGACTACTCATGAGATCTGG - Intergenic
1002817489 6:693732-693754 CAGTGCCTCCTCCTGACCTGAGG - Intergenic
1002895583 6:1378382-1378404 CTGTGCCGCCTCGCGAGTCCTGG + Intergenic
1009618133 6:66037642-66037664 CAGTGAGTTCTCATGAGTTCTGG - Intergenic
1010507165 6:76674840-76674862 CAGTGTCTCCTGGTAAGATCTGG + Intergenic
1011687419 6:89834746-89834768 CAGTGCTTCCTGCTGATTTCAGG - Intronic
1015201439 6:130585958-130585980 CAGTGCCTGCTCTTGACATCTGG - Intergenic
1018088226 6:160323359-160323381 CAGTGAGTTCTCGTGAGATCTGG + Intergenic
1018645988 6:165948881-165948903 CTGTGCCACCACGTGAGGTCAGG + Intronic
1019087928 6:169499689-169499711 CAGTGCCTTCTCCTGTGTTCTGG - Intronic
1020317201 7:6914236-6914258 GAGTGAGTCCTCGTGAGATCTGG + Intergenic
1023286925 7:38630691-38630713 CAGTGCTGTCTGGTGAGTTCTGG - Intronic
1024603248 7:51005254-51005276 CAGTGACTCCTCATGCCTTCAGG + Intergenic
1030710863 7:112747494-112747516 GAGTGCGTCCTCATGAGATCTGG + Intergenic
1031544571 7:123035416-123035438 CAGTGCCTCCTCATGATGACTGG - Intergenic
1034145586 7:148868443-148868465 CAGTGAGTTCTCGTGAGATCTGG - Intronic
1035049836 7:155992356-155992378 CAGTGCTTCCCCCTGAGCTCAGG - Intergenic
1035433225 7:158838106-158838128 CAGTGCATTCTCGTGAGACCTGG - Intergenic
1037974314 8:23199255-23199277 CAGTGTCTGCTGGTGAGTTGGGG - Exonic
1041483485 8:58348804-58348826 CAGTGCCTCCTTCTGATTCCTGG - Intergenic
1042187309 8:66149742-66149764 CAGTTTCTCCTCTTGGGTTCGGG - Exonic
1048039141 8:130708126-130708148 TAGTGACTTCTCGTGAGATCTGG - Intergenic
1053121458 9:35550278-35550300 CAGTGCTTTCTCCTGACTTCAGG - Intronic
1053662595 9:40294473-40294495 GAGTGACTTCTCGTGAGATCTGG + Intronic
1053913044 9:42924648-42924670 GAGTGACTTCTCGTGAGATCTGG + Intergenic
1054374725 9:64440698-64440720 GAGTGACTTCTCGTGAGATCTGG + Intergenic
1054522016 9:66081811-66081833 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1061153429 9:128842623-128842645 CAGTGCCTCCACGAGAGATGGGG + Intronic
1203708155 Un_KI270742v1:71059-71081 GAGTGACTTCTCGTGAGATCTGG + Intergenic
1186685649 X:11922344-11922366 CAGTGACTTCTCATGAGATCTGG - Intergenic
1189364073 X:40374742-40374764 CAGAGCCTCCTGCTGAGATCTGG - Intergenic
1195697343 X:107676823-107676845 CTGGGGCTCCTGGTGAGTTCCGG - Intergenic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic