ID: 1180997178

View in Genome Browser
Species Human (GRCh38)
Location 22:19971375-19971397
Sequence GGTTAGTTAGAGCTCCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997178 Original CRISPR GGTTAGTTAGAGCTCCTGGG GGG Intronic
900375072 1:2350538-2350560 GTTGAGTGTGAGCTCCTGGGAGG + Intronic
901702640 1:11053818-11053840 GGTGAGTTAGGGCTCCAAGGTGG + Intergenic
901955613 1:12783048-12783070 GGATAGTTAGAGCATTTGGGGGG - Intergenic
901978983 1:13019099-13019121 GGATAGTTAGAGCATTTGGGGGG - Intronic
902003099 1:13209839-13209861 GGATAGTTAGAGCATTTGGGGGG + Intergenic
902022322 1:13355589-13355611 GGATAGTTAGAGCATTTGGGGGG + Intergenic
903777536 1:25802284-25802306 TGATAGTTATAGCTCCTGGCTGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
907374218 1:54022306-54022328 GGTTAGTTAGAACTGATGGCAGG + Intergenic
909903103 1:81161750-81161772 GGTTGGGAAGAGCACCTGGGAGG + Intergenic
913372822 1:118119456-118119478 GGATATTTGGAGCTCCTGGAGGG - Intronic
1064346150 10:14534370-14534392 TGTTAGTCACAGCTCCAGGGCGG - Intronic
1068982161 10:63073068-63073090 GGTTGGTGAGAGCTGCTGTGGGG + Intergenic
1072973909 10:100041161-100041183 GGTTAATTAGAGGTGCTGTGGGG + Intergenic
1074928875 10:118103284-118103306 GGTCAGATAGAGCACCTGGGAGG - Intergenic
1078415022 11:11157777-11157799 TGGTAGTTAGAGCTCCAAGGTGG + Intergenic
1083454127 11:62766829-62766851 GGTTAGTCAGTTCCCCTGGGTGG - Intergenic
1089643711 11:119864364-119864386 GGTCAGTAAGAGCTGGTGGGTGG - Intergenic
1091263596 11:134253460-134253482 GGGTTGTTAGGGCTCGTGGGAGG + Intergenic
1092625474 12:10322537-10322559 GGTGGGTAAGAGCTCTTGGGAGG - Intergenic
1092935600 12:13360798-13360820 GGTTAGTAAAAGATTCTGGGAGG - Intergenic
1100696513 12:97099610-97099632 GGTGAGTAAGGGGTCCTGGGAGG - Intergenic
1106651933 13:31700632-31700654 AGTGAGTTAGATCTCATGGGAGG - Intergenic
1107368710 13:39716667-39716689 GGTTAGTTATATTTCCTGAGTGG + Intronic
1119895446 14:78215784-78215806 GGTTAGTTTGTGCACCTAGGTGG + Intergenic
1122643230 14:103174710-103174732 GTTTAGTTAAAGGTCCAGGGAGG - Intergenic
1123541392 15:21295273-21295295 CCTTGGTCAGAGCTCCTGGGAGG + Intergenic
1128046226 15:64619940-64619962 GGTTATTCAGTGCTCCTGGCAGG - Intronic
1202949705 15_KI270727v1_random:22414-22436 CCTTGGTCAGAGCTCCTGGGAGG + Intergenic
1139566670 16:67781911-67781933 GGATAGTGGGAGCTTCTGGGTGG - Intronic
1151964595 17:77424901-77424923 GGGTACCTAGAACTCCTGGGAGG + Intronic
1155240495 18:23859698-23859720 AGTTTGGGAGAGCTCCTGGGTGG - Intronic
1155498425 18:26464724-26464746 GGAGAGCTAGAGCTCCTGGGAGG - Intronic
1156953372 18:42932262-42932284 GCTTAGTTACACCTCCTGAGTGG + Intronic
1157040784 18:44036583-44036605 GTTTAGATATAGCTCCTTGGTGG - Intergenic
1160094243 18:75856853-75856875 GGTTAGTTTGAGCACCAGAGGGG - Intergenic
1162804765 19:13131569-13131591 TCTGAGTTTGAGCTCCTGGGCGG + Intronic
1167679380 19:50909805-50909827 GGGTAGTCAGGGCTCCTGGGAGG + Intronic
929979650 2:46666494-46666516 GGCCAGTTGGAGCTCCCGGGCGG + Intergenic
930842137 2:55859285-55859307 GGTTAATTTGAGCTCCTGTCTGG - Intergenic
940043568 2:149386004-149386026 GGTTAATTACAGGTCTTGGGGGG - Intronic
943390618 2:187263236-187263258 AAATAGTAAGAGCTCCTGGGAGG + Intergenic
947524763 2:230871346-230871368 GGTTTGCAAGAGCTCCTGGGTGG + Intronic
1170473486 20:16691163-16691185 GGAAAGTTAAAGCACCTGGGTGG - Intergenic
1171321007 20:24244297-24244319 GATTAGCTTGAGCTCCTGGAAGG + Intergenic
1172056696 20:32159158-32159180 TGTTACTCACAGCTCCTGGGAGG + Intronic
1174400033 20:50271016-50271038 CGTTAGTTAAAGCGCCTGCGCGG + Intergenic
1175697535 20:61113764-61113786 GTCTAGGTAGAGCACCTGGGAGG + Intergenic
1176238335 20:64064468-64064490 GGTCATTTGGAGCTCCTGGCTGG + Intronic
1178404886 21:32315924-32315946 GGGCCGTTAGAGCTCCAGGGAGG - Intronic
1179925494 21:44531879-44531901 GCGTGGCTAGAGCTCCTGGGCGG + Intronic
1180997178 22:19971375-19971397 GGTTAGTTAGAGCTCCTGGGGGG + Intronic
955517172 3:59737708-59737730 GGTTAGCTAGAGCTTATGTGAGG + Intergenic
962450998 3:135516898-135516920 GGTTCTTAAAAGCTCCTGGGCGG + Intergenic
962841247 3:139234873-139234895 GGTTAGTTAGTGCCACTTGGAGG - Intronic
962904121 3:139786651-139786673 GTTTAGGAAGGGCTCCTGGGAGG + Intergenic
962950316 3:140212687-140212709 AGTTTGTTAGAGCTAGTGGGAGG - Intronic
963614476 3:147518206-147518228 CGTTACTTACAGGTCCTGGGCGG + Intergenic
967982620 3:195074822-195074844 GGGTACTTAGAGCTCCGTGGTGG - Intronic
978743711 4:112167297-112167319 GTTTAGTTAGAACTCCTTAGGGG - Intronic
988788500 5:34585822-34585844 GGTGAATAAGAGCTCCTGGTGGG - Intergenic
995844627 5:116480521-116480543 GGTTTGTTTGTGCTTCTGGGAGG - Intronic
1000030979 5:157401305-157401327 GGTAAGTAAGAGACCCTGGGTGG + Intronic
1000155303 5:158545377-158545399 GGATTGCTTGAGCTCCTGGGAGG - Intergenic
1000978085 5:167786768-167786790 GCTAAGTTAAAGCTCCTGGGTGG - Intronic
1005994431 6:30922793-30922815 GGTGAGCTAGAGCTGGTGGGGGG - Intronic
1007212888 6:40211098-40211120 GGTTAATTAGTGCTCATGTGGGG - Intergenic
1012530120 6:100225510-100225532 GGTTAGTGTGATCTCTTGGGTGG + Intergenic
1013413387 6:109902313-109902335 GCATAGTTACAGCTCCTGGTTGG + Intergenic
1027467235 7:78531011-78531033 GAGTAGTAAGGGCTCCTGGGAGG + Intronic
1029618436 7:101674856-101674878 GCTTGTTTAGAGTTCCTGGGTGG - Intergenic
1031126206 7:117776031-117776053 GTGTATTTAGAGCTCCTGGTTGG - Intronic
1035162363 7:156960626-156960648 GGTTAGTTTGAGAGCCTGGAGGG + Intronic
1042152360 8:65801541-65801563 CGTTAGTAAGAGTTACTGGGGGG - Intronic
1044792803 8:95864980-95865002 GGTATGTTAGAGCTCATGTGGGG + Intergenic
1046933797 8:119867355-119867377 GATTAGTAAGACTTCCTGGGAGG + Intergenic
1047456708 8:125020403-125020425 GCTTAGTTAGAGATACTGGTTGG + Intronic
1048195612 8:132329616-132329638 GGTTAGTTAGAGCTATCTGGGGG - Intronic
1048673632 8:136752029-136752051 TGTTAGGCAGAGCTCCTGGCTGG + Intergenic
1191067548 X:56366772-56366794 GGTTGGGTAGACCTGCTGGGTGG - Intergenic
1191695429 X:63985389-63985411 GGCTAGTTACAGCTGCTTGGAGG + Intergenic
1193925587 X:87479687-87479709 GGTTGGCTAGAGCTGCTGGTTGG + Intergenic
1197717821 X:129722186-129722208 GGTTTCTTTGACCTCCTGGGAGG - Intergenic
1198795385 X:140389015-140389037 GGTTAGTTAAAGCTCCAAGAAGG + Intergenic
1199684568 X:150254808-150254830 GGGTAGCTAAAGCCCCTGGGAGG + Intergenic