ID: 1180997721

View in Genome Browser
Species Human (GRCh38)
Location 22:19973745-19973767
Sequence GCGCAAAGAGCGCGGGCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 81}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997721_1180997726 -1 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997726 22:19973767-19973789 CACTGTGGCGCGGATGTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 17
1180997721_1180997730 16 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997730 22:19973784-19973806 ACGTGGCCCACTGCGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1180997721_1180997729 15 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180997721_1180997727 9 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997727 22:19973777-19973799 CGGATGTACGTGGCCCACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1180997721_1180997735 23 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997735 22:19973791-19973813 CCACTGCGGAGGCGGGGAGAGGG 0: 1
1: 0
2: 4
3: 16
4: 286
1180997721_1180997731 17 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997731 22:19973785-19973807 CGTGGCCCACTGCGGAGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 96
1180997721_1180997728 12 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997728 22:19973780-19973802 ATGTACGTGGCCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1180997721_1180997733 22 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997733 22:19973790-19973812 CCCACTGCGGAGGCGGGGAGAGG 0: 1
1: 0
2: 2
3: 28
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997721 Original CRISPR GCGCAAAGAGCGCGGGCTGC CGG (reversed) Exonic
903063511 1:20685739-20685761 GTGCAAAGGACGAGGGCTGCAGG - Intronic
905308542 1:37034599-37034621 GCGGAGGGAGCGCGGGCGGCGGG - Intergenic
908605328 1:65792370-65792392 TGGGAAAGAGCGCGGGCGGCCGG + Intergenic
912497284 1:110099779-110099801 GCCCAAAGAGAGGGGACTGCTGG + Intergenic
921355529 1:214281299-214281321 GGGCAAAGGCCGGGGGCTGCGGG + Exonic
922785525 1:228280636-228280658 GCGCAAAGATGGCGTGCAGCTGG + Exonic
923522059 1:234742742-234742764 GCTCAGAGAGGACGGGCTGCGGG - Intergenic
1062895005 10:1096692-1096714 GCGCGCAGAGCGGGGGCTGCTGG + Intronic
1063443036 10:6089029-6089051 GGTCAGGGAGCGCGGGCTGCCGG - Intronic
1070472856 10:76801208-76801230 GAGCAAAGAGCTGTGGCTGCTGG - Intergenic
1074419866 10:113299250-113299272 CTGCAAGGAGTGCGGGCTGCAGG + Intergenic
1074591993 10:114822121-114822143 GCGGTAAGGCCGCGGGCTGCGGG + Exonic
1076382814 10:130036866-130036888 GAGCAAAAAGTGCGGGATGCTGG - Intergenic
1076752326 10:132549755-132549777 GGGCAGAGAGTGGGGGCTGCAGG - Intronic
1078526560 11:12105901-12105923 GAGCAAAGAGCTGTGGCTGCAGG - Intronic
1083176035 11:60951093-60951115 GGGCGAGGAGCGCGGGCAGCCGG + Exonic
1089752278 11:120660374-120660396 CCTCAAGGAGTGCGGGCTGCAGG - Exonic
1090699324 11:129279663-129279685 GCGCGAGGAGGGCGGGCGGCGGG + Intergenic
1091790273 12:3268187-3268209 ACGCACAGAGGGCAGGCTGCAGG - Intronic
1091790321 12:3268449-3268471 ACGCACAGAGGGCAGGCTGCAGG - Intronic
1091790352 12:3268617-3268639 ACGCACAGAGGGCAGGCTGCAGG - Intronic
1091790398 12:3268857-3268879 ACGCACAGAGGGCAGGCTGCAGG - Intronic
1091790450 12:3269117-3269139 ACGCACAGAGGGCAGGCTGCAGG - Intronic
1091790515 12:3269443-3269465 ACGCACAGAGGGCAGGCTGCAGG - Intronic
1094403999 12:30094928-30094950 GCGGGGAGAGAGCGGGCTGCAGG - Intergenic
1096072517 12:48783179-48783201 GGGCAAGGAGCTGGGGCTGCGGG - Exonic
1097938651 12:65279411-65279433 GCGCAGGGAGGGCGGGCGGCGGG - Intronic
1103927423 12:124430628-124430650 CCGCAAGCAGCGCGAGCTGCAGG - Exonic
1104676590 12:130715555-130715577 GAGCAGTGTGCGCGGGCTGCTGG - Intronic
1106226814 13:27792497-27792519 GCCCAAAGAGCGCGGGGTGCTGG - Intergenic
1106242143 13:27920797-27920819 GCGCTGGGAGCGCGGGCTCCTGG - Intronic
1107987960 13:45792118-45792140 CCAGAAAGAGCACGGGCTGCAGG - Intronic
1110874339 13:80490669-80490691 GCGCAAGCATGGCGGGCTGCAGG + Intergenic
1123995743 15:25716615-25716637 GTGCCAAGAGCGCTTGCTGCAGG + Intronic
1124198658 15:27656915-27656937 GTGCCGAGAGCGAGGGCTGCGGG + Intergenic
1129196856 15:73973596-73973618 GCGCCGAGAGCGAGGGCTGCAGG - Intergenic
1132293985 15:100721580-100721602 GGGAAAGGAGGGCGGGCTGCAGG + Intergenic
1135577390 16:23596236-23596258 GCGCAAAGGCCGCGGGCAGGCGG + Exonic
1137268642 16:46887888-46887910 GAGCACAGAGCTGGGGCTGCAGG - Intronic
1142985825 17:3695011-3695033 GCTCAGAGAACGCGGACTGCTGG + Intronic
1147305807 17:39563679-39563701 GCGGAAAGAGCGCAGGATGGCGG + Intronic
1147830747 17:43297057-43297079 AGGCGAGGAGCGCGGGCTGCTGG + Intergenic
1147996812 17:44363977-44363999 GCGCAGAGCGCGGGGGCTGCGGG - Intergenic
1152354117 17:79798355-79798377 GCGCGAAGATGGCGGGCTCCTGG + Intronic
1157419314 18:47531914-47531936 CGGCCAAGAGCGCGGGCGGCCGG - Intergenic
1158436111 18:57436310-57436332 GCGCGACGAGCGCGGGCTCCCGG + Exonic
1160858972 19:1229698-1229720 GGGCCAGGCGCGCGGGCTGCGGG + Exonic
1162995684 19:14333663-14333685 GCGGGAAGGGCCCGGGCTGCCGG - Intergenic
1163159707 19:15457354-15457376 GCGCAGGCAGCGCGGGCTCCAGG + Exonic
1163674325 19:18647810-18647832 GAGCAAAGAGCTGGGGATGCCGG - Intronic
1165603398 19:37078191-37078213 GCGCACTGAGCGCGGGCGGGCGG + Intronic
1165816871 19:38647901-38647923 GCGCAAGGTGCGCGGCCCGCGGG + Exonic
1167216673 19:48170079-48170101 GACGGAAGAGCGCGGGCTGCGGG - Intronic
926247527 2:11132123-11132145 GCGCAGAGTGCCCGGGGTGCAGG - Intergenic
948254285 2:236554655-236554677 GCGCAAACAGCAGGGGGTGCAGG + Intergenic
1169257494 20:4110378-4110400 TCGCTAAGAGCTCAGGCTGCAGG - Intergenic
1176098640 20:63355178-63355200 GCTCAGAGAGCGCTGGCTGCCGG + Intronic
1180997721 22:19973745-19973767 GCGCAAAGAGCGCGGGCTGCCGG - Exonic
1182647980 22:31825876-31825898 GTGGAAAGAGCGCAGGCTCCAGG + Intronic
1183069585 22:35386906-35386928 GCGCACAGAGCCCGAGCTGCTGG + Exonic
950707734 3:14793415-14793437 GCCCAAGGAGCCAGGGCTGCTGG + Intergenic
952816557 3:37452311-37452333 GCGCCGAGCGCGCGGGCCGCGGG - Exonic
961028884 3:123585036-123585058 GCGCTAGGAGAGCGGGCTTCGGG - Exonic
961831841 3:129627025-129627047 GCGGGACGAGCACGGGCTGCGGG - Intergenic
964282284 3:155079858-155079880 GCCCAAGGCGCGCGGGCTCCAGG - Intronic
968040321 3:195583263-195583285 GCACTAAGAGCGCGGGCTTGTGG - Intronic
969428646 4:7140206-7140228 CAGCAAAGAGCGGGGGCAGCTGG + Intergenic
973849351 4:54945903-54945925 GGGCAAGGAGCGCGGGATGCTGG - Intergenic
979310479 4:119197821-119197843 GCCCAAGGAGGGCGAGCTGCAGG + Intronic
980809173 4:137853475-137853497 GCACCGAGAGCGAGGGCTGCTGG - Intergenic
982291824 4:153789337-153789359 GCGAGCAGGGCGCGGGCTGCGGG + Intergenic
996717753 5:126601234-126601256 GCTCACGGAGCCCGGGCTGCGGG + Intronic
999129462 5:149271855-149271877 CCGCAGAGAGCGCCGGCCGCTGG + Exonic
1002105067 5:176875994-176876016 GAGCGAAGAGCAAGGGCTGCCGG - Intronic
1003603825 6:7542096-7542118 GCCCGGAGAGCGCGGGCTGCGGG + Intronic
1003873564 6:10419195-10419217 GCGCAAAGCGCGCAGCCCGCGGG - Intronic
1004200298 6:13541796-13541818 GCTCAGACAGGGCGGGCTGCAGG - Intergenic
1006366848 6:33621191-33621213 GCGCGAGGAGCGCGGGGCGCGGG + Exonic
1019381607 7:727068-727090 GCGCGGCGAGCGCGGGCAGCAGG - Exonic
1021613380 7:22478951-22478973 GGGCAAGGACCCCGGGCTGCAGG - Intronic
1021678494 7:23105753-23105775 GCGCGAAGTGCGCAGGCTCCTGG + Intronic
1021845268 7:24757367-24757389 GCGCGGCGGGCGCGGGCTGCGGG - Intronic
1021847813 7:24779701-24779723 GTGGAAAGAGCCCAGGCTGCTGG - Intergenic
1024969437 7:55054884-55054906 GCGCAACGAGGCTGGGCTGCTGG - Intronic
1025320093 7:58086854-58086876 CCGCAAAAAGCCGGGGCTGCGGG - Intergenic
1029481196 7:100814005-100814027 CCGCAGAGAGCGAGGGCTGGCGG - Exonic
1033589375 7:142797162-142797184 GCTCGGTGAGCGCGGGCTGCTGG + Intergenic
1037833740 8:22204182-22204204 GCGCAAAGAGGGAGGGCAGGGGG + Intronic
1049558540 8:143296013-143296035 GCGCAGAGGGCGGGGGCAGCTGG + Exonic
1052781254 9:32783562-32783584 GCGCGCAGAGCGCGGGGCGCGGG - Exonic
1061453403 9:130681151-130681173 GCGCTGAGGGCCCGGGCTGCGGG + Intronic
1061584030 9:131554915-131554937 GCGCAGACGGCGCGGGCTGCAGG - Intergenic