ID: 1180997722

View in Genome Browser
Species Human (GRCh38)
Location 22:19973752-19973774
Sequence CCACAGTGCGCAAAGAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997722_1180997730 9 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997730 22:19973784-19973806 ACGTGGCCCACTGCGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1180997722_1180997731 10 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997731 22:19973785-19973807 CGTGGCCCACTGCGGAGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 96
1180997722_1180997729 8 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180997722_1180997733 15 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997733 22:19973790-19973812 CCCACTGCGGAGGCGGGGAGAGG 0: 1
1: 0
2: 2
3: 28
4: 287
1180997722_1180997735 16 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997735 22:19973791-19973813 CCACTGCGGAGGCGGGGAGAGGG 0: 1
1: 0
2: 4
3: 16
4: 286
1180997722_1180997727 2 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997727 22:19973777-19973799 CGGATGTACGTGGCCCACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1180997722_1180997728 5 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997728 22:19973780-19973802 ATGTACGTGGCCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1180997722_1180997726 -8 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997726 22:19973767-19973789 CACTGTGGCGCGGATGTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997722 Original CRISPR CCACAGTGCGCAAAGAGCGC GGG (reversed) Exonic
906813012 1:48848697-48848719 TCACAGTGCCCAAAGAATGCAGG - Intronic
906950932 1:50333844-50333866 CCCGAGTGAGCACAGAGCGCGGG - Intergenic
906988073 1:50708190-50708212 CCACAGTGAGCAAAGACTGGGGG + Intronic
913077649 1:115354366-115354388 CCACAGAGAGCAATGAGCACAGG - Intergenic
919711798 1:200736556-200736578 CCATAATGCGGAAAGAGAGCAGG + Intergenic
920226504 1:204442875-204442897 CCACAGTGCACAGAGAGGGCAGG + Intronic
1071170449 10:82858022-82858044 CCACAGTGGGAAAGGAGCACAGG - Intronic
1072805128 10:98419197-98419219 CCTCAGTGAACAAAGAGTGCAGG + Intronic
1077162841 11:1121481-1121503 CCACAGAGGCCAAAGAGGGCGGG + Intergenic
1077251119 11:1561158-1561180 CCCCAGGGCCCAAAGAGTGCTGG - Intronic
1083718900 11:64594325-64594347 CCACAGTCCCCACAGAGGGCCGG + Intronic
1084502889 11:69545354-69545376 CCACTGTGCCCAAAGTGAGCAGG + Intergenic
1084713172 11:70856837-70856859 CCACACTGGGCAAAGAGTCCTGG - Intronic
1088759182 11:112913114-112913136 CAGCAGTGGGCAAAGAGTGCTGG - Intergenic
1104114307 12:125734695-125734717 CCACAGTATGCAAGGAGCTCAGG + Intergenic
1104121180 12:125801447-125801469 CCACTGTGCTCAAAGAGTGGGGG + Intergenic
1106353531 13:28957101-28957123 TCACAGTGTACAAAGAGCTCTGG + Intronic
1121607660 14:95253138-95253160 CCACAGTGGGCATGGAGCTCAGG - Intronic
1122915527 14:104856646-104856668 CCACAGCGAGCAAAGACCGTGGG - Intergenic
1202848373 14_GL000225v1_random:770-792 CCAGTGTGTGCAATGAGCGCAGG + Intergenic
1202850013 14_GL000225v1_random:10245-10267 CCGGTGTGCGCAATGAGCGCAGG - Intergenic
1202855068 14_GL000225v1_random:44660-44682 CCAGAGTGCACAATGAGCGCAGG - Intergenic
1202860334 14_GL000225v1_random:78178-78200 CCAGGGTGCTCAATGAGCGCAGG + Intergenic
1202863460 14_GL000225v1_random:100189-100211 CCAGTGTGCGCAATGAGCGCCGG + Intergenic
1202863925 14_GL000225v1_random:103693-103715 CCAGGGTGCGCAATGAGTGCAGG + Intergenic
1202867895 14_GL000225v1_random:135191-135213 CCACGGTGCGCAATGAGCGCAGG + Intergenic
1129163984 15:73765053-73765075 CCACAGTGTGCAAACAGCCTGGG + Intergenic
1131469178 15:92681541-92681563 CCACAGTGAGGAATGAGCACAGG - Intronic
1142016413 16:87750578-87750600 ACACAGGGCGCAGAGAGGGCTGG + Intronic
1142688068 17:1589267-1589289 CCAAAGTGTGCAGAGAGAGCTGG - Intronic
1143747221 17:9003420-9003442 CCAGAGCGCGCCAAGTGCGCAGG - Intergenic
1143764336 17:9127627-9127649 CCACAGTGGGCACAGGGGGCTGG + Intronic
1147752429 17:42744672-42744694 CCCCAGCGCCCAAAGGGCGCGGG - Intronic
1158343796 18:56494185-56494207 GCACAGTGAGCAAAGAGGGGTGG - Intergenic
1161576452 19:5057157-5057179 CCACAGTGTGCAGAGGGGGCTGG - Intronic
929552795 2:42905065-42905087 CCACAGTGCCCAAAGCAAGCTGG - Intergenic
931881917 2:66577366-66577388 CCTCAGTGGGCTGAGAGCGCCGG - Intergenic
933657930 2:84905024-84905046 CCAACCTGAGCAAAGAGCGCTGG + Intronic
937080725 2:119137770-119137792 CCACAGTGGCCAGAGAGGGCAGG + Intergenic
939885590 2:147677853-147677875 CCACAGTGCCCACACAGCTCTGG + Intergenic
947094511 2:226550855-226550877 CCACAGGGCGATAAGAGAGCGGG + Intergenic
948601744 2:239111462-239111484 CCACAGTGGGCACAGCGCGGGGG - Intronic
1168805609 20:670647-670669 CCACAGTGGGCAAAGGGCAGCGG - Intronic
1180997722 22:19973752-19973774 CCACAGTGCGCAAAGAGCGCGGG - Exonic
1182782644 22:32880469-32880491 CCACTTTGAGGAAAGAGCGCTGG + Intronic
950431716 3:12954711-12954733 CCACAGTGCCTAAATAGGGCTGG + Intronic
951447346 3:22798229-22798251 CCCCAGTGTGAAAAGAGAGCAGG - Intergenic
960201966 3:114847806-114847828 CCACAGGGTGCAAAGAACCCTGG - Intronic
961445110 3:126976821-126976843 GTACAGTGTGCAAAGAGCACTGG + Intergenic
965521045 3:169668552-169668574 CCACGGGCCGCAAAGGGCGCGGG + Intergenic
965773899 3:172209105-172209127 CTACAGTGCGCAGTGAGCGGGGG + Intronic
966866690 3:184262006-184262028 CCACAGCGCGGGAAGAGCTCGGG + Intronic
967264883 3:187681767-187681789 CCACAATGAGCAATGAGCACAGG + Intergenic
969619034 4:8269776-8269798 CCCCAGGGCGCAGGGAGCGCAGG - Exonic
970229100 4:13890802-13890824 CCACAGGGCACAAAGTGGGCAGG - Intergenic
971029999 4:22625574-22625596 CCACAGTGAGGAAAGGACGCTGG + Intergenic
995364569 5:111343566-111343588 CCACAGTGTGGCAAGAGAGCTGG - Intronic
996318453 5:122187679-122187701 CCACAGTGCTCACAGAGAGCAGG - Intergenic
997474264 5:134133605-134133627 CCACCGGGCGCAAAGCGGGCTGG + Intronic
1001455808 5:171858797-171858819 CAACAGTGCACAAAGTGCGATGG - Intergenic
1024309470 7:47956261-47956283 CTACAGTGGGAAAAGAGAGCGGG + Intronic
1028986879 7:97016458-97016480 GCACTGTGTGCAAAGACCGCGGG + Intergenic
1031920017 7:127593629-127593651 CCACAGTGGGGAAAGGGCCCTGG - Exonic
1032670015 7:134074060-134074082 TCACAGTGCCCACAGAGGGCAGG - Intergenic
1035282499 7:157786861-157786883 CCACAGTGGGCACTGAGCTCTGG - Intronic
1039506519 8:38056506-38056528 GCACAGTGTGCACAGAGCTCTGG + Intronic
1041419280 8:57648331-57648353 CCACAGTGGGCAAAGTCCTCAGG + Intergenic
1043813198 8:84768405-84768427 GTACAGTGGGCAAAGAGCTCAGG - Intronic
1044381740 8:91541767-91541789 CCATAGTGAGTAAAGAGCTCTGG - Intergenic
1056793417 9:89640487-89640509 CCACAGAGCGCATGGAGCCCGGG - Intergenic
1057759219 9:97859309-97859331 CCACAGAGAGCAGAGAGGGCAGG + Intergenic
1058663047 9:107283521-107283543 CCCCAGAGCGCGAGGAGCGCGGG + Exonic
1060930432 9:127486371-127486393 CCACAGTGCCCAGTGAGCACAGG - Intronic
1203736876 Un_GL000216v2:145076-145098 CCAGGGTGCGCAATGAGCGCAGG - Intergenic
1203740394 Un_GL000216v2:172323-172345 CCAGGGTGCGCAATGAGTGCAGG - Intergenic
1203740869 Un_GL000216v2:175823-175845 CCAGGGTGTGCAATGAGCGCAGG - Intergenic
1190454660 X:50615955-50615977 CTACAGTGCTCAAAGAGCACCGG + Intronic
1199812142 X:151360364-151360386 CCAGGGTGCCCAAAGAGCCCCGG + Intergenic
1201176080 Y:11308769-11308791 CCGGAGTGCGCAATGAGCGCAGG - Intergenic
1201177332 Y:11316781-11316803 CCAGGGTGTGCAATGAGCGCAGG - Intergenic
1201178447 Y:11323419-11323441 CCGTGGTGCGCAATGAGCGCAGG - Intergenic
1201180058 Y:11334191-11334213 CCTGGGTGCGCAATGAGCGCAGG - Intergenic