ID: 1180997724

View in Genome Browser
Species Human (GRCh38)
Location 22:19973753-19973775
Sequence GCCACAGTGCGCAAAGAGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997724_1180997729 7 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180997724_1180997727 1 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997727 22:19973777-19973799 CGGATGTACGTGGCCCACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1180997724_1180997731 9 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997731 22:19973785-19973807 CGTGGCCCACTGCGGAGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 96
1180997724_1180997735 15 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997735 22:19973791-19973813 CCACTGCGGAGGCGGGGAGAGGG 0: 1
1: 0
2: 4
3: 16
4: 286
1180997724_1180997726 -9 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997726 22:19973767-19973789 CACTGTGGCGCGGATGTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 17
1180997724_1180997728 4 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997728 22:19973780-19973802 ATGTACGTGGCCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1180997724_1180997730 8 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997730 22:19973784-19973806 ACGTGGCCCACTGCGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1180997724_1180997733 14 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997733 22:19973790-19973812 CCCACTGCGGAGGCGGGGAGAGG 0: 1
1: 0
2: 2
3: 28
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997724 Original CRISPR GCCACAGTGCGCAAAGAGCG CGG (reversed) Exonic
901294969 1:8154172-8154194 GCCACAGAGCGCAAAGGCCGGGG - Intergenic
906379926 1:45326348-45326370 GCCTCAGTGCACAAATAGCTGGG - Intergenic
906988071 1:50708189-50708211 GCCACAGTGAGCAAAGACTGGGG + Intronic
908311889 1:62892373-62892395 GCCACAGTACGCAAACATTGCGG - Intergenic
911200012 1:95034903-95034925 GGCACAGAGGGCAAAGAGAGAGG - Intronic
912385296 1:109268453-109268475 GCAACAGTGAGCACAGAGGGAGG + Intronic
913497126 1:119438694-119438716 GCCACAGTGCACAAAGCTCCAGG + Intergenic
915124917 1:153657208-153657230 GCTACAGTGAGCCAAGATCGTGG - Intergenic
919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG + Intergenic
1066172822 10:32869976-32869998 GCTACAGTAAGCAAAGAGCATGG - Intronic
1075554863 10:123423052-123423074 GCCAAAGTGCACAAAGAACAGGG + Intergenic
1077273690 11:1693665-1693687 GCCACTGGGGGCAAAGAGGGGGG - Intergenic
1078452205 11:11448866-11448888 GCCCCAGTGTGCAAACAGAGAGG + Exonic
1079693988 11:23455799-23455821 GCCACACTGAGCAAAGAGAGTGG + Intergenic
1080262428 11:30364140-30364162 GTCACAGTGTGCAAAGAGCAAGG - Intergenic
1082259949 11:50071168-50071190 GCCACAGTGAGGCAAGAGCTGGG + Intergenic
1089744210 11:120605732-120605754 GCCACGCTGGGCACAGAGCGTGG + Intronic
1098514162 12:71354389-71354411 GCCACAGTGCAGAAAGGGCAGGG + Intronic
1102193518 12:111007469-111007491 GTCTCAGTGCACAAAGAGCTTGG - Intergenic
1104121178 12:125801446-125801468 ACCACTGTGCTCAAAGAGTGGGG + Intergenic
1107447322 13:40480693-40480715 GCCACGGTGCCCAGAGAGGGAGG - Intergenic
1113942561 13:114025963-114025985 GTCACAGAGCCCAAAGAGCAGGG + Intronic
1114092589 14:19302643-19302665 GGCTCAGTGGGCAAAGAGAGGGG + Intergenic
1122127014 14:99584755-99584777 GCCCCACTGCCCACAGAGCGGGG + Intronic
1122222276 14:100247494-100247516 GCCTCAGTGCCCCAAGAGCTGGG + Intronic
1122915529 14:104856647-104856669 TCCACAGCGAGCAAAGACCGTGG - Intergenic
1123024650 14:105419139-105419161 GCCTCACTGCGGAAAGAGCACGG + Intronic
1129163982 15:73765052-73765074 CCCACAGTGTGCAAACAGCCTGG + Intergenic
1133602186 16:7350366-7350388 GACACAGTGGGTAAAGAGGGAGG + Intronic
1133969805 16:10559370-10559392 GCCACAGTGAGCATGGAGCTGGG - Intronic
1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG + Intergenic
1139513232 16:67439052-67439074 CCCACAGTGTGGAAAGAGCTTGG + Exonic
1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG + Intergenic
1147752431 17:42744673-42744695 GCCCCAGCGCCCAAAGGGCGCGG - Intronic
1148356387 17:46978558-46978580 GCGGCAGAGCGCAGAGAGCGGGG + Exonic
1158878316 18:61753148-61753170 GCAGCAGTGGGCAAAGAGCCTGG + Intergenic
1165901575 19:39171801-39171823 GCCACAGTGAGCTGAGAACGTGG - Intronic
1166738401 19:45099570-45099592 GTCACAGTGTGCAAAGGGCCTGG - Intronic
933862917 2:86487890-86487912 GCCACAGTGCAAAACGAGCAAGG - Intronic
936637352 2:114273812-114273834 GCCACAGGGCACAGAGAGTGAGG + Intergenic
939237908 2:139521138-139521160 GCCACAGACTGCAAAGAGCCAGG + Intergenic
939737428 2:145865829-145865851 CCCACAGTGTGCAAAAAGAGAGG - Intergenic
943637235 2:190319646-190319668 GCCACAGTGGGAAAAGGGCCGGG - Intronic
948042809 2:234917052-234917074 GCCACAGTGCTCAGAAAGCCAGG + Intergenic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
1170413982 20:16120742-16120764 GCAACTGTGTGCAAACAGCGTGG - Intergenic
1172961882 20:38805814-38805836 GCCGCAGAGCGCAAGGAGGGTGG - Intronic
1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG + Intergenic
1174197811 20:48785932-48785954 GCCACAGGGCAGAAAGAGCCGGG + Intronic
1177363917 21:20109160-20109182 GTCAGAGTGCACAAAGAGAGGGG + Intergenic
1178902133 21:36606371-36606393 GCCACAGTGTGCGGAAAGCGAGG - Intergenic
1180488140 22:15819923-15819945 GGCTCAGTGGGCAAAGAGAGGGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
965521043 3:169668551-169668573 GCCACGGGCCGCAAAGGGCGCGG + Intergenic
965773898 3:172209104-172209126 CCTACAGTGCGCAGTGAGCGGGG + Intronic
970813876 4:20129831-20129853 GACACAGTGCATACAGAGCGGGG + Intergenic
975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG + Intergenic
975705787 4:77110847-77110869 GCCACTGTGAGAAAAGGGCGGGG - Intergenic
987230238 5:15886385-15886407 GCCATAGTGAGAAAAGAGCAAGG - Intronic
989523212 5:42424484-42424506 GACACAGCGCGCAGAGCGCGCGG + Exonic
999252334 5:150190276-150190298 GCCCCGGAGCGCAGAGAGCGAGG - Exonic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1004090014 6:12491433-12491455 GCCAGAGTGTGCAAAGAATGAGG + Intergenic
1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG + Intronic
1017474449 6:154774321-154774343 GCCACAGTGAGCTATGATCGTGG - Intronic
1025912744 7:65841021-65841043 GCCACAGTGAGGCATGAGCGTGG - Intergenic
1037779916 8:21860900-21860922 GACACAGTGCGCAGAGAGCATGG + Intergenic
1040696667 8:50007679-50007701 GTCACAGTGAGCTAAGAGGGTGG + Intronic
1049504706 8:142989917-142989939 GACACAGTGCACCAAGAGCCTGG + Intergenic
1054985545 9:71258170-71258192 GCCAATGTGTGCAAAGAGCCTGG - Intronic
1060731378 9:126039187-126039209 GCCACTGTGCGCCAAGGGCTGGG - Intergenic
1061418071 9:130458754-130458776 GCCACAGTGCACAGAGCGCAGGG - Intronic
1061811147 9:133163437-133163459 GCCACAGTGAGCGGAGAGCCGGG + Intronic
1187181457 X:16946977-16946999 GGCACAGCGCGCGAAGAGCTCGG - Exonic
1199833180 X:151563664-151563686 GCCCCAGAGTGCAAAGCGCGTGG - Exonic