ID: 1180997726

View in Genome Browser
Species Human (GRCh38)
Location 22:19973767-19973789
Sequence CACTGTGGCGCGGATGTACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 17}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997720_1180997726 8 Left 1180997720 22:19973736-19973758 CCACAAGCACCGGCAGCCCGCGC 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1180997726 22:19973767-19973789 CACTGTGGCGCGGATGTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 17
1180997724_1180997726 -9 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997726 22:19973767-19973789 CACTGTGGCGCGGATGTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 17
1180997721_1180997726 -1 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997726 22:19973767-19973789 CACTGTGGCGCGGATGTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 17
1180997722_1180997726 -8 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997726 22:19973767-19973789 CACTGTGGCGCGGATGTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997726 Original CRISPR CACTGTGGCGCGGATGTACG TGG Exonic
900147423 1:1164528-1164550 CTCTGTGGGGCGGGTGGACGTGG + Intergenic
900246240 1:1637389-1637411 CCCTGGGGCGCGGCTGTACCTGG + Exonic
1097953605 12:65460478-65460500 CAGTGGGGCGGGGATGTATGTGG + Intronic
1129382081 15:75174334-75174356 CACTGTGGGGTGCATGTACTTGG - Intergenic
1165317764 19:35066968-35066990 CACTGTGCACCGGATGTACGCGG + Intergenic
1168685698 19:58347824-58347846 ACGTGTGGCGCGGATGTCCGGGG - Intronic
935492039 2:103733505-103733527 CAGTGTGGCGGGGATGTAGGTGG + Intergenic
943326567 2:186505919-186505941 CACTGTGGCTCTGATGTTGGTGG - Intronic
948557647 2:238824666-238824688 CTCTGTGGTGCAGATGTACAGGG + Intergenic
1176297369 21:5081280-5081302 CACTGTAGCCTGGATGGACGGGG - Intergenic
1179859660 21:44180668-44180690 CACTGTAGCCTGGATGGACGGGG + Intergenic
1180997726 22:19973767-19973789 CACTGTGGCGCGGATGTACGTGG + Exonic
959665767 3:108919059-108919081 CACTGTGGAGAGGGTGTAAGTGG - Intronic
967290327 3:187913628-187913650 CACTGTGGCGGGGGTGAAGGTGG - Intergenic
990606008 5:57410850-57410872 AACTGTGGCACGCATGTGCGAGG + Intergenic
997629530 5:135356341-135356363 CCCTGTGGTGAGGATGTCCGTGG + Intronic
1014943972 6:127475484-127475506 CACCGAGGCGCGCATCTACGTGG - Exonic
1031311714 7:120207240-120207262 CACTCTGGCGGGGAGGTAAGGGG - Intergenic
1049411406 8:142475492-142475514 CCCTGTGGGGCGAATGCACGCGG + Exonic
1049554644 8:143275831-143275853 CACCGTGGCACGGAGGGACGGGG - Intronic