ID: 1180997727

View in Genome Browser
Species Human (GRCh38)
Location 22:19973777-19973799
Sequence CGGATGTACGTGGCCCACTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997720_1180997727 18 Left 1180997720 22:19973736-19973758 CCACAAGCACCGGCAGCCCGCGC 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1180997727 22:19973777-19973799 CGGATGTACGTGGCCCACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1180997721_1180997727 9 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997727 22:19973777-19973799 CGGATGTACGTGGCCCACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1180997724_1180997727 1 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997727 22:19973777-19973799 CGGATGTACGTGGCCCACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1180997722_1180997727 2 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997727 22:19973777-19973799 CGGATGTACGTGGCCCACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997727 Original CRISPR CGGATGTACGTGGCCCACTG CGG Exonic
902202957 1:14847518-14847540 CAGATGTACATAGCTCACTGCGG - Intronic
918007373 1:180554513-180554535 TGGATCTACGGGGCTCACTGTGG - Intergenic
921501261 1:215906421-215906443 CTGATGTAACTGGCACACTGAGG + Intronic
1070250120 10:74766133-74766155 CGGGAGTACAGGGCCCACTGTGG - Intergenic
1074549249 10:114427652-114427674 CTGCTGGAGGTGGCCCACTGTGG - Intergenic
1078453855 11:11460009-11460031 GGGATGGACTTGACCCACTGTGG - Intronic
1080944680 11:36958192-36958214 GGGTTCTACCTGGCCCACTGGGG - Intergenic
1091315257 11:134610009-134610031 CGGATGTAAGTGTCCCTCTGGGG + Intergenic
1091615531 12:2048288-2048310 CGGTTGTGCGTGGCCCTATGTGG + Intronic
1097673796 12:62574435-62574457 CGCATGTTCATGGCTCACTGCGG + Intronic
1100615695 12:96230047-96230069 GTTATATACGTGGCCCACTGTGG - Intronic
1102038674 12:109786821-109786843 AGGATGGTGGTGGCCCACTGCGG + Exonic
1118284351 14:64457949-64457971 CGGATGATCATGGCTCACTGTGG + Intronic
1127386887 15:58474228-58474250 AGGCTTTACGTGGGCCACTGTGG + Intronic
1130911478 15:88273918-88273940 AAGATGTACCTGGTCCACTGTGG + Intergenic
1147733868 17:42621608-42621630 CCCATGTACTTGGCACACTGAGG - Intergenic
1157785466 18:50478164-50478186 TGGATGCAGGTGGCCCACAGAGG + Intergenic
1163764308 19:19154038-19154060 CCACTGTACCTGGCCCACTGTGG + Intronic
929567802 2:43000600-43000622 CAGATGTATGTGGCTGACTGTGG - Intergenic
937324404 2:120981671-120981693 CGGGTGTACGTGTCCTCCTGAGG + Intronic
1173657568 20:44710968-44710990 AGGATGTGCCTGGCCCACTTTGG + Intergenic
1176096916 20:63348585-63348607 CAGACGGAGGTGGCCCACTGAGG + Intronic
1180997727 22:19973777-19973799 CGGATGTACGTGGCCCACTGCGG + Exonic
1181390956 22:22580312-22580334 CGCATGAACTTGGACCACTGTGG - Intergenic
950407554 3:12814171-12814193 CCGGTGGCCGTGGCCCACTGTGG + Intronic
951570694 3:24059632-24059654 CAGCTGTGCTTGGCCCACTGGGG + Intergenic
953549980 3:43894623-43894645 CTGTTGGACGTGGCCGACTGCGG - Intergenic
976489947 4:85658794-85658816 AGGATGTACATGGCCAAATGTGG + Intronic
1001870756 5:175153091-175153113 GGAATGTACGTGCCCCACTTTGG - Intergenic
1012972343 6:105744665-105744687 AGGATGTACGTGGCAAACTTTGG + Intergenic
1031348026 7:120693283-120693305 CGGAAGTACGTGGTGCTCTGAGG - Intronic
1035288108 7:157819126-157819148 CGGGTGCAGGTGGGCCACTGTGG - Intronic
1036287047 8:7452137-7452159 TGGATGCAGGTGGGCCACTGTGG - Intronic
1036334434 8:7859385-7859407 TGGATGCAGGTGGGCCACTGTGG + Intronic
1048031762 8:130639794-130639816 CGGAGGTGTGGGGCCCACTGGGG + Intergenic
1049743024 8:144250040-144250062 GGGCTGTCCGTGGCCCACGGGGG + Intronic
1055992840 9:82126172-82126194 CTGCTGTATGTGTCCCACTGAGG + Intergenic
1057138362 9:92711028-92711050 CTCATGTGCGTGGCCCAGTGTGG + Intergenic
1061451242 9:130667957-130667979 CGGCTGGAAGTGGCCCACAGGGG - Intronic
1062655793 9:137604299-137604321 CGGAAGTACTTGGTCCATTGGGG + Intergenic