ID: 1180997728

View in Genome Browser
Species Human (GRCh38)
Location 22:19973780-19973802
Sequence ATGTACGTGGCCCACTGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997722_1180997728 5 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997728 22:19973780-19973802 ATGTACGTGGCCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1180997720_1180997728 21 Left 1180997720 22:19973736-19973758 CCACAAGCACCGGCAGCCCGCGC 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1180997728 22:19973780-19973802 ATGTACGTGGCCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1180997724_1180997728 4 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997728 22:19973780-19973802 ATGTACGTGGCCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1180997721_1180997728 12 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997728 22:19973780-19973802 ATGTACGTGGCCCACTGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997728 Original CRISPR ATGTACGTGGCCCACTGCGG AGG Exonic
909555573 1:76949918-76949940 ATGTACTTAGCCCATTGCTGAGG + Intronic
917794907 1:178526462-178526484 ATGAACTTGGCCAGCTGCGGTGG + Intronic
924736561 1:246762499-246762521 ATGTTCCTGGCCCACTGCTTTGG + Intronic
1068601765 10:58964260-58964282 ATGTACCAAGCCCACTGCTGTGG - Intergenic
1074211342 10:111338207-111338229 AAGTACTAGGCCCACTGGGGAGG - Intergenic
1078453854 11:11460006-11460028 ATGGACTTGACCCACTGTGGTGG - Intronic
1080944679 11:36958189-36958211 TTCTACCTGGCCCACTGGGGTGG - Intergenic
1083104805 11:60347406-60347428 ACAGACTTGGCCCACTGCGGTGG - Intronic
1095332200 12:40980143-40980165 AAGTATGTGGGCCAGTGCGGTGG + Intronic
1101335233 12:103790974-103790996 ATGTACTTGGCCGGGTGCGGTGG - Intronic
1112195188 13:97218867-97218889 ATGTTCGTGGCACACGGTGGAGG - Intergenic
1118394162 14:65321555-65321577 ATGTACGGGGGCCAGTGGGGAGG + Intergenic
1126059521 15:44766767-44766789 ATGTAAGTGGCCAGGTGCGGTGG + Intronic
1128331976 15:66761902-66761924 ATTCACATGGCCCACTGGGGTGG + Intronic
1141919552 16:87126892-87126914 TTGTAGGTGGCCCTCTGCGCCGG + Intronic
1142109978 16:88326067-88326089 ATGTCTGTGGCCCATTGCTGGGG - Intergenic
1143742583 17:8965422-8965444 GTGGACCTGGCCCACCGCGGGGG - Intronic
1144110004 17:12021470-12021492 CTGAGCGGGGCCCACTGCGGCGG - Intronic
1147733866 17:42621605-42621627 ATGTACTTGGCACACTGAGGCGG - Intergenic
1148501727 17:48096800-48096822 CTGCACCTGGCCCACTGTGGTGG - Intronic
1164169636 19:22713882-22713904 ATGGACGGAGCCCACTGCTGAGG - Intergenic
1164324990 19:24183364-24183386 ATGAATGTGGCCCACTGTTGAGG - Intergenic
1167802646 19:51754806-51754828 ATGTTTGTGGCCCAGTGCAGTGG - Intronic
925926798 2:8676755-8676777 ATGGACTTGGCTCGCTGCGGAGG + Intergenic
928164909 2:28963718-28963740 GTGTACCTGGCCGAATGCGGTGG + Intronic
929567801 2:43000597-43000619 ATGTATGTGGCTGACTGTGGTGG - Intergenic
942556469 2:177177177-177177199 AAATACGTGGCCCAATGCAGTGG + Intergenic
947219200 2:227776795-227776817 ATGTAAGTTGCCCACAGTGGAGG - Intergenic
1174364426 20:50047885-50047907 AAGTACTTGGCCGAGTGCGGTGG - Intergenic
1180997728 22:19973780-19973802 ATGTACGTGGCCCACTGCGGAGG + Exonic
949700382 3:6749900-6749922 ATGTATGAGGCCGAGTGCGGTGG + Intergenic
950682241 3:14593355-14593377 ATGTTCATGGCCCAGTGGGGAGG - Intergenic
954006907 3:47598540-47598562 ATGTATGTGGCCCAGTGCAGTGG + Intronic
984177432 4:176436798-176436820 ATGTACGTGGCCCTCCCCTGTGG - Intergenic
986733046 5:10649307-10649329 GTGTAAGTGGCCCACTCCTGCGG - Exonic
993470290 5:88299373-88299395 ATGTACCTGGCCCAGCGCAGTGG - Intergenic
994410776 5:99404581-99404603 AGGCACGTGGCCAAGTGCGGTGG - Intergenic
998285570 5:140857342-140857364 CTGGCCGTGGCCCACAGCGGAGG - Exonic
1044555326 8:93556619-93556641 AAGTACGTGGCCCAGGGCTGGGG - Intergenic
1055426640 9:76203532-76203554 ATGGACTTGGCCCACAGCCGAGG + Intronic
1055487757 9:76773729-76773751 ATGTACTTGGCCGGGTGCGGTGG - Intronic
1056428798 9:86506288-86506310 AAGTACGTGGCCATGTGCGGTGG + Intergenic
1061394158 9:130334175-130334197 ATGGGCCTGGCCCCCTGCGGAGG + Intronic
1187679187 X:21749700-21749722 ATATACCTGGCCCAGTGCAGTGG - Intronic