ID: 1180997729

View in Genome Browser
Species Human (GRCh38)
Location 22:19973783-19973805
Sequence TACGTGGCCCACTGCGGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997720_1180997729 24 Left 1180997720 22:19973736-19973758 CCACAAGCACCGGCAGCCCGCGC 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180997724_1180997729 7 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180997721_1180997729 15 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180997722_1180997729 8 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997729 Original CRISPR TACGTGGCCCACTGCGGAGG CGG Exonic
902970593 1:20045302-20045324 TACTTGCCCCCCTGGGGAGGTGG + Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
1076566138 10:131400733-131400755 TGCCTGGGCCACCGCGGAGGCGG + Intergenic
1076701305 10:132274763-132274785 GAGGTGGCCGACTGCCGAGGAGG - Intronic
1082735365 11:56849301-56849323 AAAGTGGCCCATTGCAGAGGAGG + Intergenic
1084169087 11:67391924-67391946 CACGTGGACCAATGGGGAGGCGG + Intronic
1086426420 11:86688350-86688372 TTCGGGGCCCTCTGAGGAGGAGG - Intergenic
1094503066 12:31037398-31037420 CATGTGGCCCACAGCAGAGGTGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG + Exonic
1134238468 16:12486318-12486340 TACAGGGGCCACTGCAGAGGAGG - Intronic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1152598297 17:81248982-81249004 CACGTGGCCCACGGCCGAGGTGG - Intronic
1153219308 18:2847681-2847703 CCCGTCGCCCTCTGCGGAGGCGG - Intronic
1161531392 19:4792120-4792142 CAGGTGGCCGGCTGCGGAGGCGG - Exonic
1166836630 19:45671227-45671249 CACTTGGCCCACTGCGCAGTAGG + Intronic
1166837892 19:45678269-45678291 TTCGTGCCCCTCTGGGGAGGAGG - Intronic
926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG + Intergenic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
936071709 2:109375620-109375642 GCCCTGGCCCACTGGGGAGGAGG - Intronic
942444897 2:176071378-176071400 GAGGTGGCCCACTCCGGAGAGGG + Intergenic
948443568 2:238014055-238014077 TACCTGGCCCAAGGCGGAGACGG - Intronic
948888014 2:240893464-240893486 TGCGTGGCCCACGGCAGATGAGG - Intronic
1174002203 20:47383034-47383056 TGAGTGGCCCACTGCAGAAGAGG + Intergenic
1179256047 21:39716138-39716160 TAGTTGCACCACTGCGGAGGAGG + Intergenic
1179562114 21:42222084-42222106 TATGTGGCCCGGTGCGGGGGTGG + Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183990678 22:41595285-41595307 AAGGTGGCCCACTGGGCAGGAGG + Intergenic
1184152281 22:42646119-42646141 TACTTGGCCCACTGCTGGTGAGG - Intronic
949351310 3:3127122-3127144 TATTTTGCCCACTGCTGAGGAGG - Intronic
950904826 3:16528651-16528673 TAAGTGGCCCACTGGGGACTGGG - Intergenic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
968461899 4:730373-730395 CACGTGGCCCACGGGGGTGGGGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
982642717 4:157983375-157983397 TAAGTGGAAAACTGCGGAGGTGG - Intergenic
998504768 5:142663622-142663644 TACACAGCCCACAGCGGAGGAGG + Intronic
1002187773 5:177462526-177462548 TGCGTTGCTCACAGCGGAGGGGG - Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG + Intergenic
1041213646 8:55578431-55578453 TATGTGACCAACTGGGGAGGGGG + Intergenic
1052831777 9:33221580-33221602 TACCTGGTCCACAGCAGAGGTGG + Intronic
1059734550 9:117088282-117088304 TACGTGGTACACTGGGGAAGGGG - Intronic
1192316400 X:70055128-70055150 TACATGGACCATTGCTGAGGAGG + Intergenic