ID: 1180997730

View in Genome Browser
Species Human (GRCh38)
Location 22:19973784-19973806
Sequence ACGTGGCCCACTGCGGAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997722_1180997730 9 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997730 22:19973784-19973806 ACGTGGCCCACTGCGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1180997721_1180997730 16 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997730 22:19973784-19973806 ACGTGGCCCACTGCGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1180997724_1180997730 8 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997730 22:19973784-19973806 ACGTGGCCCACTGCGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1180997720_1180997730 25 Left 1180997720 22:19973736-19973758 CCACAAGCACCGGCAGCCCGCGC 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1180997730 22:19973784-19973806 ACGTGGCCCACTGCGGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997730 Original CRISPR ACGTGGCCCACTGCGGAGGC GGG Exonic
900147161 1:1163323-1163345 ACGTCGGCCACGGCGGGGGCTGG - Intergenic
900180430 1:1308751-1308773 ACGTGGGCCCGGGCGGAGGCGGG + Intronic
903807946 1:26018738-26018760 AAGTGAGCCACTGCGGTGGCTGG - Intergenic
904590172 1:31609381-31609403 ATGTGGCCCAGGGTGGAGGCTGG + Intergenic
915338928 1:155165943-155165965 CCCTGGCCCCCTGCAGAGGCTGG + Intergenic
916607301 1:166355697-166355719 ACGTGGCCCAAAGAGGATGCAGG + Intergenic
917170700 1:172170399-172170421 ACGGGGCCCACTCTGGAGTCAGG + Intronic
922051456 1:221994423-221994445 AGGTAGCCCACTGTGGAGTCAGG + Intergenic
922502929 1:226110217-226110239 GCGTGGGCCGCGGCGGAGGCCGG + Intergenic
1063408585 10:5819024-5819046 ACGTGGCTGACAGCTGAGGCTGG + Intronic
1064050258 10:12053873-12053895 TCTTGGCTCACTGCCGAGGCTGG + Intergenic
1075323958 10:121515122-121515144 ACGTATCCCCCTGCGGAGACAGG - Exonic
1075615139 10:123885241-123885263 AGCTGCCCCACTCCGGAGGCTGG + Intronic
1075950129 10:126469956-126469978 ACGTTGCATGCTGCGGAGGCAGG + Intronic
1077198529 11:1293558-1293580 ACCTGGCCCAGTGAGGAGGCAGG + Intronic
1078581476 11:12542579-12542601 ATGTGGCTCACTGAGGAGGCAGG + Intergenic
1083318434 11:61830101-61830123 ACGCGGCCCAGTGAGGAGGTTGG + Intronic
1084169088 11:67391925-67391947 ACGTGGACCAATGGGGAGGCGGG + Intronic
1090223529 11:125053224-125053246 ACCTGGCCCACTGAGGCAGCAGG + Intergenic
1102109416 12:110353327-110353349 ACGTGGCCCACGGGCCAGGCTGG + Intergenic
1104958159 12:132475867-132475889 CCGTCGCCCACCCCGGAGGCTGG + Intergenic
1104958171 12:132475895-132475917 CCGTCGCCCACCCCGGAGGCTGG + Intergenic
1108180031 13:47831673-47831695 TGGTGGCCAGCTGCGGAGGCAGG - Intergenic
1117438960 14:55742803-55742825 AAATGGCCCACTGCAGATGCAGG + Intergenic
1125524770 15:40368024-40368046 TCGTGGAGCACGGCGGAGGCGGG - Exonic
1132752347 16:1464631-1464653 ACGTGGCCCAGGGCAGAGCCAGG + Intronic
1134095204 16:11414401-11414423 ACGTGGCCCACTGCAGCTGGTGG - Exonic
1136399020 16:30007782-30007804 TAGTGGGTCACTGCGGAGGCAGG - Intronic
1141133727 16:81452245-81452267 ACCTGGGACACTGCAGAGGCAGG - Intronic
1141441379 16:84031758-84031780 TCGTGGCTCACTGCAGAGCCTGG - Intronic
1141500103 16:84438247-84438269 AAGTGGGCCACTGCTGAAGCTGG - Intronic
1141824707 16:86471034-86471056 CCCTGGCCCACTCTGGAGGCTGG - Intergenic
1144110002 17:12021466-12021488 GCGGGGCCCACTGCGGCGGCGGG - Intronic
1145797986 17:27667028-27667050 CAGTCGCCCACTGCGGAGACAGG - Intergenic
1150143629 17:62750392-62750414 TCCTGGGCCACTGGGGAGGCAGG + Intronic
1152350308 17:79780500-79780522 GCTTGGCCCACTTCAGAGGCTGG + Intronic
1153219306 18:2847680-2847702 CCGTCGCCCTCTGCGGAGGCGGG - Intronic
1154340378 18:13497878-13497900 ACGTGTCCCACTGTGGACACTGG + Intronic
1154340485 18:13498515-13498537 ACGTGTCCCACTGTGGACACTGG + Intronic
1154340504 18:13498635-13498657 ACGTGTCCCACTGTGGACACTGG + Intronic
1154340517 18:13498715-13498737 ACGTGTCCCACTGTGGACACTGG + Intronic
1157607125 18:48932952-48932974 CCGTGGTCCACTGAGGAGCCTGG + Intronic
1161513202 19:4683062-4683084 ACCCGGCCCTCTGCGGCGGCGGG - Intronic
1163818191 19:19480737-19480759 ACGAGGACCACTGAGGGGGCTGG - Intronic
1165850443 19:38847385-38847407 ATGTGGACAACTGGGGAGGCAGG + Exonic
1166699549 19:44874346-44874368 CCCTGGGCCACTGCGGAGGTCGG - Exonic
1167408984 19:49333960-49333982 TCGGGCCCCACTGCAGAGGCAGG + Intergenic
925040746 2:731723-731745 CCTGGGCCCAGTGCGGAGGCCGG + Intergenic
930865889 2:56121545-56121567 ACTGGGCCCACTGAGCAGGCTGG + Intergenic
936048654 2:109206057-109206079 ACAATGCCCACCGCGGAGGCTGG - Intronic
937370411 2:121293671-121293693 CCGTGGCCCCCTGCAGAGACTGG - Intergenic
937884230 2:126889235-126889257 GTGTGGCCCACTGGGGAGCCAGG - Intergenic
944667121 2:201967719-201967741 AAGGGGCTAACTGCGGAGGCGGG + Intergenic
1170697762 20:18675116-18675138 AAGTGGCCCACTACAGAGGCTGG + Intronic
1178931863 21:36826239-36826261 AAGTGGGCCACTGCTGAGGAAGG - Intronic
1180997730 22:19973784-19973806 ACGTGGCCCACTGCGGAGGCGGG + Exonic
1181085409 22:20437409-20437431 TCGTGGCCCATGGCCGAGGCTGG + Intronic
1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG + Intergenic
1184321510 22:43745336-43745358 ACGTGGCCCTTCCCGGAGGCAGG + Intronic
1184332105 22:43833725-43833747 CCGTAGCCCACTGCGGAGACAGG + Exonic
949849705 3:8410731-8410753 ACTGGGCCCACTGCAGATGCTGG + Intergenic
953404846 3:42655020-42655042 ACGTGGCCCAAGGCCCAGGCGGG - Intronic
953518765 3:43621908-43621930 ACGTGGAGCGCTGCGGCGGCTGG - Exonic
961352154 3:126310974-126310996 CCGCGGCCCACTCTGGAGGCTGG + Intergenic
961819955 3:129570977-129570999 CCGAGGCCCACAGCTGAGGCTGG + Intronic
968461898 4:730372-730394 ACGTGGCCCACGGGGGTGGGGGG - Intronic
985759266 5:1736704-1736726 AAGTTGCCCACTGCAGAGCCTGG - Intergenic
985897085 5:2755148-2755170 ACGCGGCCGACTGAGAAGGCCGG + Exonic
991514343 5:67417159-67417181 ATGGGGCCCACAACGGAGGCTGG - Intergenic
999497653 5:152115856-152115878 ATGTGGCCCACAGAGGGGGCAGG - Intergenic
1001402509 5:171454036-171454058 ACTTGGGCTAATGCGGAGGCAGG + Intronic
1007231830 6:40353654-40353676 ACATGGGGCACTGAGGAGGCAGG + Intergenic
1010157718 6:72814086-72814108 GCGTGGCCCAGTGCAGAGCCAGG + Intronic
1011659082 6:89578695-89578717 ACCTGGCCCACTGCTGGTGCAGG - Intronic
1019748180 7:2712363-2712385 ACGTGGCCCAGCCAGGAGGCGGG + Exonic
1022141857 7:27499772-27499794 ACTGTGCCCACTGTGGAGGCTGG + Intergenic
1023638737 7:42237731-42237753 ACTTCGCCCCCTGCGGCGGCAGG - Intronic
1037761484 8:21744661-21744683 TCTTGGCCCACTGTGGGGGCTGG + Intronic
1045252704 8:100494956-100494978 TCCTGGCCCACTGCAGAGCCTGG + Intergenic
1049614031 8:143568614-143568636 CCGCGGCCCCCTGCGGAAGCTGG - Exonic
1049822047 8:144641469-144641491 AGGTGGCCAACTCCCGAGGCAGG + Intergenic
1050858773 9:10396826-10396848 AATTGGCCCAGTGGGGAGGCAGG + Intronic
1061028644 9:128066794-128066816 CCGGGGCCCACTGAGGAGGACGG - Exonic
1062477488 9:136735992-136736014 AGGTGGCACGCTGCGGAGGGAGG + Intergenic
1187546984 X:20265380-20265402 ACTTCTCACACTGCGGAGGCCGG + Intronic
1192111913 X:68373577-68373599 ACGTGGGCCAGTGCTGAGGTAGG - Intronic