ID: 1180997731

View in Genome Browser
Species Human (GRCh38)
Location 22:19973785-19973807
Sequence CGTGGCCCACTGCGGAGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997724_1180997731 9 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997731 22:19973785-19973807 CGTGGCCCACTGCGGAGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 96
1180997721_1180997731 17 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997731 22:19973785-19973807 CGTGGCCCACTGCGGAGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 96
1180997722_1180997731 10 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997731 22:19973785-19973807 CGTGGCCCACTGCGGAGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 96
1180997720_1180997731 26 Left 1180997720 22:19973736-19973758 CCACAAGCACCGGCAGCCCGCGC 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1180997731 22:19973785-19973807 CGTGGCCCACTGCGGAGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997731 Original CRISPR CGTGGCCCACTGCGGAGGCG GGG Exonic
900314490 1:2050260-2050282 CGCGGCCCAATGGCGAGGCGCGG - Intergenic
900415503 1:2532719-2532741 CCTGGCCCACTGCGGGTGGGCGG - Intergenic
900584529 1:3426037-3426059 GCTGGCTCACTGCGGAGGGGCGG - Exonic
905016426 1:34781714-34781736 CGGGGCCCACAGCAGAGGCGAGG - Exonic
906365357 1:45205822-45205844 CGCGGCCGGCTGCGGTGGCGAGG - Exonic
907372106 1:54010357-54010379 TGTGGCCCACTGTGGAGACCCGG - Exonic
907481937 1:54750950-54750972 CCTGGCCCACAGCAGAGGCTTGG - Intergenic
915338930 1:155165944-155165966 CCTGGCCCCCTGCAGAGGCTGGG + Intergenic
919895698 1:202008446-202008468 ACTGGCCCAGTGCGGGGGCGGGG + Exonic
922502930 1:226110218-226110240 CGTGGGCCGCGGCGGAGGCCGGG + Intergenic
923013899 1:230110828-230110850 CGTGGAAAACTGGGGAGGCGTGG + Intronic
923592165 1:235328490-235328512 CGTGGACCGGTGCGGGGGCGGGG + Intronic
1063663979 10:8051061-8051083 CATGGCGCAGAGCGGAGGCGCGG - Intergenic
1070328273 10:75401596-75401618 GGTGGCCCGCAGCGGAGCCGTGG + Exonic
1077522869 11:3046613-3046635 CCTGACCCACGGCAGAGGCGGGG + Intronic
1079339623 11:19601366-19601388 GGAGGGCCACTGCGGAGGCAAGG - Intronic
1084169089 11:67391926-67391948 CGTGGACCAATGGGGAGGCGGGG + Intronic
1084934324 11:72579001-72579023 CGTAGCCCACTGTTGAGGGGAGG + Exonic
1086426418 11:86688348-86688370 CGGGGCCCTCTGAGGAGGAGGGG - Intergenic
1096106521 12:48999357-48999379 CGGCGCCCACTGCAGAGCCGCGG + Intergenic
1096660847 12:53123125-53123147 CATGGGCCACTGCGGAGACCAGG - Exonic
1104958160 12:132475868-132475890 CGTCGCCCACCCCGGAGGCTGGG + Intergenic
1108180030 13:47831672-47831694 GGTGGCCAGCTGCGGAGGCAGGG - Intergenic
1108674684 13:52726106-52726128 CGAGGCTCACTGCTGAGGCTTGG + Intronic
1114626955 14:24136323-24136345 AAGGGCCCACTGGGGAGGCGTGG + Intronic
1128781145 15:70359471-70359493 AATGGGCCACTGCTGAGGCGAGG + Intergenic
1132079492 15:98852351-98852373 CTTGGTCCACGGCGGCGGCGCGG - Intronic
1132546519 16:535796-535818 CCTGGCCCACAGCAGAGGCCCGG + Intronic
1132641583 16:980809-980831 CCTGGGCGCCTGCGGAGGCGGGG - Intronic
1133346129 16:5071768-5071790 CTCGGCCCACTTCGGAGGCTCGG + Intronic
1136399019 16:30007781-30007803 AGTGGGTCACTGCGGAGGCAGGG - Intronic
1136529552 16:30858539-30858561 TGGGGCCCACTGAGGAGGCCTGG - Intronic
1138207544 16:55135762-55135784 CCTGGCCCACTGAGAAGGCATGG + Intergenic
1139805985 16:69565931-69565953 CGTGGGGCACAGCGCAGGCGCGG - Intronic
1141441378 16:84031757-84031779 CGTGGCTCACTGCAGAGCCTGGG - Intronic
1144110001 17:12021465-12021487 CGGGGCCCACTGCGGCGGCGGGG - Intronic
1147544956 17:41394035-41394057 CAGGGCCCACAGCGGGGGCGTGG + Exonic
1147738877 17:42659215-42659237 CGAGTCTCACTGCGCAGGCGCGG + Intergenic
1151438468 17:74113392-74113414 AGTAGCCCACGGCGGGGGCGGGG + Intergenic
1152363621 17:79843425-79843447 CGTGCCGCAATGCGGAGGCGCGG - Intergenic
1154252282 18:12754738-12754760 CGTGACCCGCTGCAGAAGCGAGG - Intergenic
1156703739 18:39855388-39855410 CCTGGCTCACTGCAGAGGCAAGG + Intergenic
1160872747 19:1284575-1284597 CGTGGCCCGCTGGGGAATCGGGG + Intergenic
1161006775 19:1941126-1941148 CGCGCCCCACTGCGCAGCCGCGG - Intergenic
1161069040 19:2251371-2251393 CGTGGCCCACGGCGCCGACGTGG - Exonic
1161513200 19:4683061-4683083 CCCGGCCCTCTGCGGCGGCGGGG - Intronic
1163777452 19:19226732-19226754 CATGGCCCACTGGGGAAGTGTGG + Exonic
1163790492 19:19303276-19303298 CGTGCCCCAATGCGGAATCGGGG - Intronic
1166699547 19:44874345-44874367 CCTGGGCCACTGCGGAGGTCGGG - Exonic
1166750487 19:45162037-45162059 CCTGGCCCACCAGGGAGGCGGGG + Intronic
1166831213 19:45640872-45640894 CGTGGTCAACTCCAGAGGCGGGG - Intronic
1167131331 19:47588010-47588032 CCTGGACCAGTGTGGAGGCGTGG - Intergenic
1167414611 19:49363504-49363526 CGTGGTCCAGTGCAGGGGCGTGG + Intronic
1167414616 19:49363522-49363544 CGTGGCCCAGTGCAGGGGCGTGG + Intronic
1167469177 19:49665959-49665981 CCCGGCCCAGTGCGCAGGCGCGG + Exonic
925040747 2:731724-731746 CTGGGCCCAGTGCGGAGGCCGGG + Intergenic
937884229 2:126889234-126889256 TGTGGCCCACTGGGGAGCCAGGG - Intergenic
944667122 2:201967720-201967742 AGGGGCTAACTGCGGAGGCGGGG + Intergenic
948460165 2:238125307-238125329 CGTGGCCAACAGTGGAGGTGGGG - Exonic
949012147 2:241686948-241686970 CGCGGCCCAGGGCGCAGGCGCGG - Exonic
1168814652 20:728311-728333 CCGGGCCAGCTGCGGAGGCGGGG + Intergenic
1170697763 20:18675117-18675139 AGTGGCCCACTACAGAGGCTGGG + Intronic
1172445227 20:34989898-34989920 GGTGGTCCACTACGCAGGCGTGG + Exonic
1176053898 20:63134691-63134713 CGGGGCCCAGAGGGGAGGCGGGG + Intergenic
1176054035 20:63134992-63135014 CGGGGCCCAGAGGGGAGGCGGGG + Intergenic
1176054161 20:63135292-63135314 CGGGGCCCAGAGGGGAGGCGGGG + Intergenic
1176054202 20:63135380-63135402 CGGGGCCCAGAGGGGAGGCGGGG + Intergenic
1176054258 20:63135504-63135526 CGGGGCCCAGAGGGGAGGCGGGG + Intergenic
1176054291 20:63135575-63135597 CGGGGCCCAGAGGGGAGGCGGGG + Intergenic
1179607274 21:42524947-42524969 CGTGGACCTCTGGGGAGGGGAGG + Intronic
1179818033 21:43920572-43920594 CGTGGACCTCTGGGGAGGGGAGG + Intronic
1180997731 22:19973785-19973807 CGTGGCCCACTGCGGAGGCGGGG + Exonic
1181085410 22:20437410-20437432 CGTGGCCCATGGCCGAGGCTGGG + Intronic
1182781586 22:32872814-32872836 CTTGGCCCACTGTCGAGGCTCGG - Intronic
1183386618 22:37518938-37518960 CGTGGCCCACTCGGGACCCGCGG + Intronic
1183744823 22:39686228-39686250 CGTGGGCCAGGGCGGCGGCGTGG - Exonic
1183990680 22:41595287-41595309 GGTGGCCCACTGGGCAGGAGGGG + Intergenic
1184332106 22:43833726-43833748 CGTAGCCCACTGCGGAGACAGGG + Exonic
1184617155 22:45645913-45645935 GGGGGCGCATTGCGGAGGCGGGG - Intergenic
954450244 3:50567686-50567708 CGGGACCCACGGCGGAGGTGGGG + Exonic
960874360 3:122282269-122282291 CTTGGTCCACTTCGGAGGCCTGG + Intronic
962604909 3:137025098-137025120 CGTGTCCCACTGAGGAGTGGAGG + Intergenic
966108176 3:176362307-176362329 AGGAGCCCACTGCGGGGGCGAGG + Intergenic
968461897 4:730371-730393 CGTGGCCCACGGGGGTGGGGGGG - Intronic
968506519 4:973573-973595 CCTGCCCCACTGCGCAGGCGCGG + Intronic
968655043 4:1774802-1774824 CGTGGCCCAGTGTGGGGGCCTGG + Intergenic
969323934 4:6430060-6430082 CGTGGCCCACTTATGAGGTGGGG - Intronic
976297320 4:83485148-83485170 CGGGGCCCAGCGAGGAGGCGGGG + Exonic
977941939 4:102868874-102868896 CGCGGCGGACTGCCGAGGCGCGG - Exonic
996552800 5:124747638-124747660 CTTCGCCCACTGCGGGGGGGCGG - Intronic
1013227937 6:108134019-108134041 CGGGGCCTCCTGCGGCGGCGAGG + Intronic
1019748181 7:2712364-2712386 CGTGGCCCAGCCAGGAGGCGGGG + Exonic
1022955743 7:35378400-35378422 CTTGGCCCACTGTGGGGGTGGGG + Intergenic
1029134448 7:98359211-98359233 GGTGGCACACTGCTGGGGCGTGG - Intronic
1036126308 8:6065988-6066010 GGTGTCCCACTGAGGAGGGGTGG + Intergenic
1045252706 8:100494957-100494979 CCTGGCCCACTGCAGAGCCTGGG + Intergenic
1049988427 9:972169-972191 CGAGGCGCCCTGCGGAGGCGCGG - Intergenic
1061394160 9:130334180-130334202 CCTGGCCCCCTGCGGAGGAACGG + Intronic
1062650199 9:137572114-137572136 CGTGAGCCACGGCGGAGGTGAGG + Intronic
1062677222 9:137753609-137753631 CGTGGCCTCCTGTGGAGGGGTGG + Intronic
1189002791 X:36963744-36963766 CGCGGCCCGCGGCGGAGGTGGGG - Intergenic
1190598061 X:52066198-52066220 CGTGGCCCACAAGGGAGGAGAGG + Intronic
1190610763 X:52187875-52187897 CGTGGCCCACAAGGGAGGAGAGG - Intronic
1198705835 X:139447125-139447147 CTGGGCGCGCTGCGGAGGCGCGG - Intergenic
1201896135 Y:18994380-18994402 TGTGGGCCACTGTGGAGGTGGGG + Intergenic