ID: 1180997733

View in Genome Browser
Species Human (GRCh38)
Location 22:19973790-19973812
Sequence CCCACTGCGGAGGCGGGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997721_1180997733 22 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997733 22:19973790-19973812 CCCACTGCGGAGGCGGGGAGAGG 0: 1
1: 0
2: 2
3: 28
4: 287
1180997722_1180997733 15 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997733 22:19973790-19973812 CCCACTGCGGAGGCGGGGAGAGG 0: 1
1: 0
2: 2
3: 28
4: 287
1180997724_1180997733 14 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997733 22:19973790-19973812 CCCACTGCGGAGGCGGGGAGAGG 0: 1
1: 0
2: 2
3: 28
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997733 Original CRISPR CCCACTGCGGAGGCGGGGAG AGG Exonic
900143992 1:1150181-1150203 CCCGCTGGGGAGACGGGAAGCGG - Intergenic
900190071 1:1349458-1349480 CGCACGGCGGGGGCGGGGCGAGG + Intergenic
900307570 1:2018818-2018840 CCCTCGACGGGGGCGGGGAGAGG - Intergenic
900415844 1:2534385-2534407 GCCACTGCCTGGGCGGGGAGGGG - Intergenic
901060743 1:6470881-6470903 CCCACTGCGGTGGGGGAGTGGGG + Exonic
901825604 1:11859069-11859091 CCCACGTCGCAGGCGCGGAGGGG - Intergenic
901928294 1:12580932-12580954 GCCACTCCGGAGGCTGGGATGGG - Intronic
903967367 1:27099160-27099182 CCCATTGTGGAGGCGGTGGGGGG - Exonic
904170967 1:28592131-28592153 CCCACAGAGGAGGCGGGGGGTGG + Intronic
904258636 1:29273828-29273850 CCTATTGGGGAGGTGGGGAGTGG + Intronic
905468668 1:38175481-38175503 CCCACTGGGCAGGCTGTGAGCGG - Intergenic
907406990 1:54259678-54259700 CCCACTGGGGAGGAGGGGCGTGG + Intronic
912354308 1:109042270-109042292 CCCAAAGCTGGGGCGGGGAGGGG + Intergenic
913136093 1:115890651-115890673 ACCAGTGCAGAGGTGGGGAGAGG - Intergenic
914755333 1:150558943-150558965 AGCACTGCGGAGGAGGAGAGCGG - Exonic
919878695 1:201888707-201888729 ACCACCGCGGAGCCGGGGACAGG + Exonic
920960023 1:210655812-210655834 ACCACTGCAGAAGCAGGGAGAGG - Intronic
921933013 1:220770708-220770730 CCAACAGCAGAGGCTGGGAGGGG - Intronic
922044252 1:221928280-221928302 CCTTCTGCGGAGGAGAGGAGAGG + Intergenic
922538655 1:226402463-226402485 CCCACTGCTGGGGCTGGGACTGG - Intronic
1063451325 10:6152241-6152263 CCCACTGCAGAGCCTGGGAAGGG - Intronic
1063644221 10:7862673-7862695 CCCCCTGGGGAGGAGGGAAGAGG - Intronic
1064177212 10:13085510-13085532 CCCACAACGGAGGTGGGGATGGG - Intronic
1065919023 10:30374655-30374677 CCCACTCCGGGAGAGGGGAGGGG + Intergenic
1067069995 10:43124310-43124332 CACACTGCTGGGGCGTGGAGGGG + Intronic
1070570965 10:77638757-77638779 CCCAGTGGGGAGGGGAGGAGTGG + Intergenic
1070716930 10:78729234-78729256 CCCACTATGGAGGATGGGAGGGG + Intergenic
1071356562 10:84802200-84802222 GCCACTGTTGAGGCGGGCAGGGG + Intergenic
1073088703 10:100913385-100913407 CCCTGCGCGGAGGCGGGGCGGGG - Intronic
1073156879 10:101354301-101354323 CCCACTGCGGGACCGGGCAGCGG + Intronic
1074377068 10:112949859-112949881 CCCACTTGGGGGGCGGGGATGGG - Intergenic
1074917525 10:117971819-117971841 CCCATTGAGGTGGAGGGGAGTGG + Intergenic
1075693871 10:124419237-124419259 CCCACTGCGCGGGCCGGGTGTGG + Intergenic
1075718064 10:124568521-124568543 CCCTCCGCGGTGGCGTGGAGAGG + Intronic
1076618993 10:131775091-131775113 CCCACTGGGGCGTTGGGGAGTGG - Intergenic
1076705405 10:132298589-132298611 CTCACTGGGGAGGGAGGGAGGGG + Intronic
1076796074 10:132799091-132799113 CCCACAGCACAGGCGGGCAGGGG + Intergenic
1076843729 10:133058902-133058924 CGCCCTGAGGAGGCCGGGAGGGG - Intergenic
1077211087 11:1371283-1371305 CCCCGTGAGGAGGCGGGGAGAGG - Intergenic
1077303494 11:1857563-1857585 CCCACTGCTGGGGCGGCGGGAGG + Intronic
1077490188 11:2857518-2857540 CCCTCAGCGGAGGAGGTGAGGGG - Intergenic
1078626405 11:12962665-12962687 TGCACTGCAGAGGAGGGGAGAGG - Intergenic
1078628525 11:12980646-12980668 CCCTCTGAGGAGGCAGGAAGAGG - Intergenic
1078857309 11:15216796-15216818 CCCAGTGAGGAGGCTGGGACAGG + Intronic
1083204971 11:61143198-61143220 CTCACAGGGGAGGCTGGGAGAGG + Intronic
1084118550 11:67055956-67055978 CCCTCTGCGGGGGCGGGGTGGGG + Intergenic
1084146772 11:67269185-67269207 ACCACTGGGGCGGCGGGGGGCGG - Intronic
1084648546 11:70474664-70474686 GCCACTGGGGAGGGGAGGAGAGG + Intronic
1084669359 11:70596200-70596222 CCCACAGAGCAGGCGGGGAAGGG - Intronic
1085423135 11:76380867-76380889 TGCCCTGAGGAGGCGGGGAGGGG - Exonic
1085524517 11:77156641-77156663 CCCACTGCAGAGGGAGGGAGTGG - Exonic
1086464313 11:87037820-87037842 CGCACCGGGGAGGCGGGGAGAGG - Intergenic
1091705641 12:2691383-2691405 GCGTCTGCAGAGGCGGGGAGAGG + Intronic
1091909777 12:4220215-4220237 CCCACGGTGGGGGTGGGGAGTGG + Intergenic
1092123034 12:6057743-6057765 CCCACCGCGGAGGGCGGGGGCGG - Intronic
1093921707 12:24866373-24866395 CCCACAGCGGTGGCGGGGGGCGG - Intronic
1095942905 12:47738090-47738112 GGCACTGCGGGGGTGGGGAGGGG + Exonic
1096780957 12:53991863-53991885 CCCACTGGGGAGGGTAGGAGTGG - Intronic
1097848667 12:64390618-64390640 TCCAGCGCGGGGGCGGGGAGAGG - Exonic
1099292190 12:80787131-80787153 CAGACTGGGGAGGAGGGGAGAGG + Intergenic
1102024088 12:109703644-109703666 CTCACAGTGCAGGCGGGGAGAGG - Intergenic
1102725867 12:115064078-115064100 CCCACTGCTGAGTAGAGGAGTGG + Intergenic
1103517321 12:121515761-121515783 CCCAGTGTGCAGGCGGAGAGAGG - Intronic
1103903574 12:124315850-124315872 CCCTCTGTGGAGGTGAGGAGGGG + Exonic
1104079248 12:125415706-125415728 CGCAGTGGGGAGGAGGGGAGTGG + Intronic
1104783959 12:131437971-131437993 CCCACTGCCGTGGTGGGGTGGGG - Intergenic
1104823506 12:131692658-131692680 CGTGCTGCGGAGGCGGGGAGGGG + Intergenic
1106458503 13:29948287-29948309 CCCACCCCGGAGCCGGGGACAGG + Intergenic
1106546703 13:30737171-30737193 CCAACTGCACAGGCAGGGAGGGG - Intronic
1110064562 13:71087516-71087538 CCCACTGCGCGGGCGGGGGGGGG - Intergenic
1113779752 13:112969271-112969293 GGCGCGGCGGAGGCGGGGAGGGG - Exonic
1114557005 14:23567826-23567848 CCCGTGGTGGAGGCGGGGAGAGG - Exonic
1115284286 14:31700822-31700844 CCCACGGTGGTGGGGGGGAGGGG - Intronic
1116582097 14:46654688-46654710 CACACTTCGGAGGCGCGGTGCGG + Intergenic
1119843959 14:77814584-77814606 CCCACTCCGGAGGCTGAGATGGG + Intronic
1119877256 14:78071361-78071383 CCCACAGTGGAGGTGGGGTGGGG + Intergenic
1121253364 14:92514952-92514974 CCCACTGCCAAGCCAGGGAGCGG - Intronic
1122141706 14:99666798-99666820 CCCACTGGGGAGGTCGGGGGAGG - Intronic
1122497452 14:102169047-102169069 CACACTGGGGAATCGGGGAGGGG - Intronic
1123048160 14:105528303-105528325 CCCAGTGCGGCGGCGGGGAGAGG + Intronic
1125519524 15:40340204-40340226 CCCCCTGAGGAGGCAGGGACAGG - Intronic
1125541142 15:40470917-40470939 CCCACGCCGGGGGCGGGGAGAGG - Intergenic
1126099888 15:45112715-45112737 CAGCCTGCGGAGGCAGGGAGCGG + Exonic
1129450449 15:75648329-75648351 GCCACTTCTGGGGCGGGGAGAGG + Exonic
1129771099 15:78204103-78204125 CCCATTGAGAAGGCCGGGAGTGG - Intronic
1130653344 15:85774841-85774863 CGCACTGCGGGAGTGGGGAGGGG - Intronic
1131510035 15:93044735-93044757 CACACTGCAGGGGCGGGGCGAGG + Intronic
1132580783 16:683778-683800 ACCTCTGCGGGGGCGGGGAGGGG + Exonic
1132604480 16:788066-788088 CCGACGGTGGGGGCGGGGAGGGG + Intronic
1132641582 16:980804-980826 GCGCCTGCGGAGGCGGGGAGAGG - Intronic
1132683395 16:1152878-1152900 CCCAGTGCGGGGGCGTGGAGGGG + Intergenic
1132891238 16:2205790-2205812 CCGGCTGCGGAGGTGGGGGGGGG + Intronic
1133919483 16:10139318-10139340 CCCTGTGGGGAGGCAGGGAGAGG + Intronic
1133963658 16:10516043-10516065 CCCACTGGGGAGCCCAGGAGAGG + Intergenic
1134122917 16:11597335-11597357 CCCACTGGGGGTGTGGGGAGAGG + Intronic
1134358317 16:13505571-13505593 CCCACTGCTGAGATGTGGAGTGG + Intergenic
1134441742 16:14302773-14302795 CCCTCTGGGGAGCGGGGGAGGGG - Intergenic
1135727974 16:24871862-24871884 ATCACTGCTGAGGAGGGGAGGGG + Intronic
1136027206 16:27476358-27476380 CCCACAGCGGAGAAGGGCAGGGG + Intronic
1136081162 16:27853468-27853490 CCCTCTGAGGACACGGGGAGGGG + Intronic
1137721010 16:50627473-50627495 CCCACCGAGGAGCCAGGGAGTGG + Intronic
1140015072 16:71174731-71174753 ACCACTGCAGTGGTGGGGAGGGG - Intronic
1140359512 16:74332519-74332541 CCCACAGTGGGGGAGGGGAGGGG + Intergenic
1140484287 16:75281652-75281674 CCCACCCTGGAGGCTGGGAGGGG + Intergenic
1140872085 16:79115676-79115698 ACCAGTGCGGGGGCTGGGAGAGG - Intronic
1141555296 16:84833273-84833295 CACACAGCAGAGGCTGGGAGGGG - Intronic
1141830357 16:86506911-86506933 GCCTCTGTGTAGGCGGGGAGTGG - Intergenic
1142234363 16:88914961-88914983 CCCGCTGCCGGGGCGGGGTGGGG + Intronic
1142352667 16:89587182-89587204 CAGACTGAGGGGGCGGGGAGGGG - Intronic
1142409888 16:89910680-89910702 CCCACTGGGGAGGCAGGGGCTGG - Intronic
1142691494 17:1608682-1608704 ACCACTGCGGTGGCCGGGTGCGG - Intronic
1143813951 17:9496185-9496207 GCCACTGGGGAGGCGGAGACAGG - Intronic
1144684131 17:17215087-17215109 CCCACTGGGGAGAAGGGCAGGGG + Exonic
1144769604 17:17752322-17752344 CACACTGCGGAGGGGCGGGGCGG + Intronic
1145041287 17:19579913-19579935 CTCCATGCGGAGGCTGGGAGCGG - Intergenic
1145234596 17:21199776-21199798 CCCGCTGCGGAGGGGAGAAGAGG + Intronic
1147738878 17:42659220-42659242 CTCACTGCGCAGGCGCGGAGCGG + Intergenic
1148048722 17:44759094-44759116 CCAGCTGCGGAGCCGGGGCGGGG - Exonic
1148131396 17:45264513-45264535 CCCACTGCTGAGCCGGGGGCTGG + Exonic
1148871408 17:50660650-50660672 AGCACTGGGGAGGCGGGGAGAGG + Intronic
1149356560 17:55845602-55845624 CCCACGGCGGGGTGGGGGAGGGG - Intergenic
1149866427 17:60153737-60153759 CCCACTGCTGGGGTGGCGAGTGG + Intronic
1150620307 17:66803158-66803180 CGCCCTGGGGAGGCAGGGAGAGG - Intronic
1151438472 17:74113397-74113419 CCCACGGCGGGGGCGGGGGCGGG + Intergenic
1151755770 17:76074603-76074625 TCCACGGCGCAGGCGGAGAGTGG - Intronic
1152263649 17:79280834-79280856 CCCATTGTGGGGGGGGGGAGGGG + Intronic
1152755859 17:82086731-82086753 CCCACTGTGGACGCAGTGAGGGG + Intronic
1153770904 18:8415851-8415873 GCCACTGGGAAGGCAGGGAGTGG - Intergenic
1154954783 18:21242789-21242811 CCCCCGGCGGAGGCGGCGAGGGG + Intronic
1155654473 18:28177636-28177658 CACGCAGCGGAGGCGCGGAGTGG - Intergenic
1156350368 18:36297485-36297507 CCGGCGGCGGAGGCGGGGCGGGG - Intergenic
1158002497 18:52636024-52636046 CCAACTGCGGAAGCGGGAAAAGG + Intronic
1160310817 18:77788460-77788482 CCCAGTGGGCAGGAGGGGAGAGG + Intergenic
1160430401 18:78807483-78807505 CCCAATGCAGAGGCTGGAAGTGG + Intergenic
1160499846 18:79396201-79396223 CGCGCGGCGGCGGCGGGGAGTGG - Intronic
1160799795 19:962461-962483 CCCACTGCAGAGCCAGGGCGTGG + Intronic
1160968065 19:1755268-1755290 CCCACTCTGGAGGAGGGGAGTGG - Intronic
1161044509 19:2128114-2128136 CCCACTGCAGGGAAGGGGAGGGG - Intronic
1161221934 19:3121930-3121952 CCCTCTGCAGAGGCTGGGAAGGG + Exonic
1161298543 19:3531981-3532003 CCGACTGCAGTGGCGGGGTGCGG - Exonic
1161327522 19:3670806-3670828 CTCACTGCAGGGGCGGGGACGGG + Intronic
1161349396 19:3783774-3783796 CCCACTGCAGGGACGGGGTGGGG + Intronic
1161513195 19:4683056-4683078 CCCTCTGCGGCGGCGGGGAGGGG - Intronic
1161592886 19:5136687-5136709 CCCACTGAAGAGGCTGGGGGCGG - Intronic
1161702366 19:5802513-5802535 CCCCCAGCCGCGGCGGGGAGGGG + Intergenic
1162043668 19:7985208-7985230 ACCACTGAGGAGGCTGGGCGCGG - Intronic
1162439581 19:10684126-10684148 CCCACTGTGGGGCCGGGAAGGGG - Intronic
1163143532 19:15365597-15365619 GCCCCTACGTAGGCGGGGAGGGG + Intronic
1163720080 19:18894661-18894683 ACCACTGCGGACCCAGGGAGGGG + Intronic
1164678436 19:30118523-30118545 CCCTCTGCGGAGGCAGTGACAGG - Intergenic
1165221124 19:34317515-34317537 CCCACTGCAGACACAGGGAGGGG - Intronic
1165851386 19:38852048-38852070 CCGGCCGCGGGGGCGGGGAGGGG - Intronic
1166982548 19:46639594-46639616 CCGGCTGCGGAAGAGGGGAGGGG + Intergenic
1166985804 19:46659590-46659612 CCCACTCCTGAGAGGGGGAGGGG + Intronic
1167375269 19:49107801-49107823 CCCTGTGCGGAAGCGGGGAGGGG - Exonic
1167471906 19:49680179-49680201 CCCACAGCTGGGGAGGGGAGGGG - Intronic
1167622671 19:50568097-50568119 CCCACCCAGGAGCCGGGGAGGGG - Intergenic
1168063983 19:53909261-53909283 GCTACTGCGGAGGAGGGGAGGGG - Intergenic
1168100483 19:54138489-54138511 CCCTCGACGGTGGCGGGGAGGGG + Intronic
1168103980 19:54155595-54155617 CTCACTGGGGAGGGGAGGAGGGG - Exonic
1168555839 19:57339203-57339225 CCCACTGCAGAAGAGGGGAGGGG + Intergenic
924987973 2:288406-288428 CCCACGGAGGAGGCCGGGTGCGG + Intronic
926872862 2:17441816-17441838 CCAACTGCGGAAGCGGGAAAGGG - Intergenic
928364861 2:30692614-30692636 CCCAATGCCGAGGCAGGGAGTGG + Intergenic
929604966 2:43227594-43227616 CCCACTGCCGGGGAGGGAAGAGG - Intergenic
929787853 2:45004959-45004981 CTCGCTGCAGAAGCGGGGAGGGG - Intergenic
929966972 2:46543259-46543281 CGCTCTGGGGAGGCGGCGAGGGG - Intronic
930026929 2:47034706-47034728 CCCACTGTGGAGAGGGGAAGGGG - Intronic
931609023 2:64079253-64079275 CAGACTGGGGAGGAGGGGAGAGG + Intergenic
934131867 2:88956195-88956217 CCCACAGAGGAGGTGGGAAGGGG + Intergenic
934566217 2:95343039-95343061 ACCACAGTGGAGGTGGGGAGAGG + Intronic
935349685 2:102142696-102142718 GCCGCTGCGGGGGCGGGGAACGG - Intronic
935598487 2:104898167-104898189 CCCACTGAGGACACGTGGAGAGG + Intergenic
940112626 2:150171189-150171211 CCCATGGCGGAGGTGGGGCGGGG + Intergenic
942171271 2:173291773-173291795 TCCACTCCTGAGGCGGGGGGGGG - Intergenic
943461284 2:188173266-188173288 CGCCCTGGGGAGGAGGGGAGAGG + Intergenic
943669644 2:190648296-190648318 GCCAGAGCGGAGGTGGGGAGGGG + Intronic
943669735 2:190648708-190648730 CCCGCTCCGGGCGCGGGGAGGGG - Intronic
943699939 2:190978848-190978870 CCCAGAACGGAGGCGGTGAGTGG - Exonic
945240356 2:207671058-207671080 CTTCCTGCGGGGGCGGGGAGCGG + Intergenic
946250069 2:218406344-218406366 CCGAAGGCAGAGGCGGGGAGCGG + Intergenic
948097027 2:235343569-235343591 CCCAGGGAAGAGGCGGGGAGAGG + Intergenic
948852136 2:240713635-240713657 CCCAGTGATGAGGCAGGGAGGGG - Intergenic
948963228 2:241356330-241356352 GCGACTGCGGAGGCCGGGCGAGG + Exonic
1168814656 20:728316-728338 CCAGCTGCGGAGGCGGGGGAGGG + Intergenic
1168878217 20:1185429-1185451 GCCGCTGGGGAGGCGGGGGGGGG + Intronic
1168939219 20:1694890-1694912 CCCATAGGGGAGGTGGGGAGAGG - Intergenic
1169391733 20:5196355-5196377 TCCACTGCTGGGCCGGGGAGGGG + Exonic
1171958120 20:31475243-31475265 CCCCCGGCCGAGGCGGCGAGGGG + Intronic
1172841008 20:37902907-37902929 CCGAGTGCGGAGGCGGGGCCGGG - Intergenic
1172876107 20:38165265-38165287 GGCACTGCCGAGGCGGAGAGCGG + Exonic
1173586417 20:44186646-44186668 CGTACTGCGGGGGCTGGGAGGGG - Exonic
1173616871 20:44408956-44408978 CCCACTGAGAAGGAGGGGAGGGG + Intronic
1174342489 20:49906533-49906555 CGCCCTGCGGCGGCGGGCAGAGG - Exonic
1175091355 20:56507235-56507257 GCTACTGCGGAGATGGGGAGTGG - Intronic
1175216232 20:57392857-57392879 GCCACTGCTGGGGCGAGGAGGGG - Intronic
1175231940 20:57479423-57479445 CACACTGGGAAGGCGGAGAGTGG - Intergenic
1175728905 20:61339262-61339284 CCCACTGTGGAGGAAGGGACTGG + Intronic
1175824177 20:61927719-61927741 CCCACTGGGGAGCCAGGGAGGGG - Intronic
1175942479 20:62543949-62543971 CGCGGTGCGGGGGCGGGGAGAGG - Intergenic
1175983443 20:62752784-62752806 CCCACTCCGGCTGCTGGGAGCGG - Intronic
1176294504 21:5064242-5064264 CCCACCGAGGACTCGGGGAGGGG - Intergenic
1179862547 21:44197884-44197906 CCCACCGAGGACTCGGGGAGGGG + Intergenic
1180958447 22:19751480-19751502 CCCAGTGGGGAAGCCGGGAGAGG + Intergenic
1180997733 22:19973790-19973812 CCCACTGCGGAGGCGGGGAGAGG + Exonic
1181051596 22:20240620-20240642 GCCACTGCCCTGGCGGGGAGGGG + Intergenic
1181285305 22:21747796-21747818 GCCACTCCGGAGGCTGAGAGAGG + Intergenic
1181514534 22:23403248-23403270 CCCATTCCGCAGGCGGGAAGAGG - Intergenic
1182524647 22:30907678-30907700 CCCACTGGAGAGGCGGGGCGGGG + Exonic
1183329757 22:37212829-37212851 ACCACTGGGGAGGCCGGGTGGGG + Intergenic
1184486534 22:44783294-44783316 ACCGCTGCGGGGGTGGGGAGGGG - Intronic
1184617152 22:45645908-45645930 CGCATTGCGGAGGCGGGGGCGGG - Intergenic
1184782432 22:46655963-46655985 CCCAGAACGGAGGCGGGGCGGGG + Intronic
1184857393 22:47153879-47153901 TCCCGTGTGGAGGCGGGGAGTGG + Intronic
1185216070 22:49600647-49600669 CCCGCTGCGAAGGCGGGGAAAGG + Intronic
1185240179 22:49738286-49738308 CCCACTGAGGAGGCAGGGGCAGG - Intergenic
1185316537 22:50181607-50181629 CCCACAGAGGAGGCCTGGAGGGG + Intergenic
1185415961 22:50710411-50710433 CCCAGTGCTGAGGGGAGGAGGGG - Intergenic
949672618 3:6417160-6417182 CCTACTGTGGGGGCGGGGGGGGG + Intergenic
950481114 3:13244654-13244676 CCAGCTGCTGAGGCTGGGAGTGG - Intergenic
954450247 3:50567691-50567713 CCCACGGCGGAGGTGGGGCCGGG + Exonic
954863366 3:53708617-53708639 CCCACTGTGGAGACAAGGAGTGG + Intronic
954876248 3:53804881-53804903 CCAAGGGAGGAGGCGGGGAGAGG + Intronic
957459459 3:80497747-80497769 CCCACAGCGGGTGCTGGGAGAGG + Intergenic
961778891 3:129309866-129309888 CCCTCTCTGGAGGCTGGGAGTGG - Intergenic
964731533 3:159872005-159872027 CCCACAGGGGAGGCTGGTAGAGG - Intronic
966108178 3:176362312-176362334 CCCACTGCGGGGGCGAGGCTTGG + Intergenic
966915854 3:184583774-184583796 CCCGGGGCGGACGCGGGGAGGGG + Intronic
968985022 4:3870311-3870333 CCCAATGGGGAGGAGTGGAGGGG - Intergenic
969671410 4:8592341-8592363 CCCTGTGTGGATGCGGGGAGGGG - Intronic
969698247 4:8748097-8748119 CCCTCTGCCCAGGCGGGGGGTGG + Intergenic
971763065 4:30794044-30794066 CTCACTGGGGAGGGGAGGAGAGG - Intronic
972033328 4:34490272-34490294 CCCAATGTGGAGGTAGGGAGAGG + Intergenic
973660976 4:53105878-53105900 CCCAGTCAGGAGGCGGGGGGTGG - Intronic
975690437 4:76957654-76957676 CCCACTGGGGTGGGGTGGAGTGG - Intronic
981429824 4:144645974-144645996 CTCCCTGCTGCGGCGGGGAGGGG - Intergenic
985062870 4:186095627-186095649 CCCACTGGAGAGGAGAGGAGGGG - Intergenic
988993445 5:36692996-36693018 GCCTCTGCGGAGGCGAGCAGGGG - Intergenic
990978979 5:61584759-61584781 CCCACTGGGCAGGTAGGGAGAGG - Intergenic
991705111 5:69350121-69350143 CCCACTGCTGAGGGAGGCAGAGG + Intergenic
991769355 5:70026025-70026047 CCCCATGCAGAGGCGGAGAGGGG - Intronic
991848650 5:70901443-70901465 CCCCATGCAGAGGCGGAGAGGGG - Intronic
991899939 5:71450646-71450668 CCCCTTGCGGAGGCGGAGAGGGG + Intergenic
993545480 5:89207195-89207217 CTCAGTGTGGAGGTGGGGAGAGG + Intergenic
993916932 5:93755561-93755583 CCAACTGCGGAAGCGGGAAAGGG + Intronic
994157786 5:96523011-96523033 GCAACTGCGGAGGTGAGGAGGGG - Intergenic
996101895 5:119452730-119452752 CCCGCTGAGGTGGTGGGGAGGGG + Exonic
997473503 5:134129779-134129801 GCCACAGCGGAGGTGGGGACTGG - Intronic
999088194 5:148911938-148911960 CCCACCCCGGGGACGGGGAGTGG + Intergenic
1001396819 5:171423654-171423676 CTCACTGAGGAGGCTGGGTGTGG - Intronic
1001919869 5:175591325-175591347 GCCACTGGTGAGGCGGTGAGGGG - Intergenic
1002691340 5:181052888-181052910 CCGCCTGCGGACGCGGGGCGAGG + Intronic
1002924794 6:1599159-1599181 CCACCTGCGGAGGCCTGGAGAGG + Intergenic
1003078038 6:2999753-2999775 CGCACCGCCGGGGCGGGGAGTGG + Intronic
1004075636 6:12341856-12341878 CGCACTGCGGAGTGTGGGAGGGG + Intergenic
1004396398 6:15249021-15249043 GCCACTTGGGAAGCGGGGAGCGG + Intronic
1005710281 6:28497868-28497890 CCCACTTCTGAGGAGGGCAGAGG - Intergenic
1005898728 6:30199067-30199089 CCCACTACGGAGCCTGGAAGAGG - Exonic
1006400163 6:33813089-33813111 CCCTCTGGGGGGGCGGGGGGCGG + Intergenic
1006426120 6:33963921-33963943 CCCACTGAGGAGGATGGTAGAGG + Intergenic
1006448744 6:34093780-34093802 CCCACAGGGGAGGCGGAGAGCGG - Intronic
1006472226 6:34235647-34235669 CCCGGCGCGGAGGCGGGGTGGGG - Intergenic
1006950750 6:37819724-37819746 CGGCCTGCGGAGACGGGGAGGGG - Exonic
1007431575 6:41780109-41780131 CCTGCGGCGGAGGCGGGGCGCGG + Intronic
1008816901 6:55579192-55579214 CGCACTGCGGCGGCGCCGAGAGG + Intronic
1011075271 6:83431400-83431422 CCCAGGGCGGGGGCAGGGAGCGG + Intergenic
1011128736 6:84033708-84033730 CCCGCAGCGGAGGCGGCGCGGGG - Intergenic
1011636138 6:89375579-89375601 TCCACTGGGCAGGTGGGGAGGGG + Intronic
1018488075 6:164262746-164262768 CCCAATGTGGAGTGGGGGAGGGG - Intergenic
1019340675 7:507469-507491 CCCCCTGAGGAGGCTGGGTGGGG - Intronic
1019788876 7:2997420-2997442 CCCACAGGGGAGGCAGGGCGAGG + Intronic
1020237780 7:6369886-6369908 CCCACTGGGGAGGAGGGTGGAGG - Intergenic
1021660520 7:22914765-22914787 CAGACTGGGGAGGAGGGGAGAGG - Intergenic
1022739943 7:33111162-33111184 CCCACTGGGGAGATGAGGAGAGG + Intergenic
1023306008 7:38827599-38827621 CCCACTGCCAAGATGGGGAGAGG + Intronic
1023995287 7:45155937-45155959 CCCACTGCAGAGCCAGGGTGGGG + Intergenic
1025992146 7:66504401-66504423 CCCTCTGCAGAGGCTGGGAAGGG - Intergenic
1026929462 7:74215811-74215833 CCCAGTGCAGGAGCGGGGAGGGG + Intronic
1029218487 7:98969645-98969667 CCAACTGCAGAGGCAGGCAGGGG + Intronic
1029422322 7:100477901-100477923 CCCATTGGGCAGGCGGGGCGGGG + Exonic
1029494089 7:100887999-100888021 ATTACTGCGGGGGCGGGGAGGGG - Intronic
1029538434 7:101169164-101169186 CCCACTCCTGAGTGGGGGAGGGG + Intergenic
1029706826 7:102280574-102280596 ACGGCTGCAGAGGCGGGGAGGGG + Intronic
1031423097 7:121572635-121572657 CCCACTGTTCAGGCGGGGCGCGG - Intergenic
1034539044 7:151744418-151744440 CCCACTGCAGTGGTGGGGTGGGG - Intronic
1035229866 7:157458505-157458527 CCCACAGCGGGGATGGGGAGCGG - Intergenic
1035732024 8:1860198-1860220 GCCACTTCGGGGGCGTGGAGAGG - Intronic
1035732035 8:1860233-1860255 GCCACTTCGGGGGCGTGGAGAGG - Intronic
1037731121 8:21524704-21524726 CCCACTGAGGAGCAGGGGAATGG + Intergenic
1037926725 8:22849395-22849417 CCCACTGCACAGGCAGGGAAAGG + Intronic
1038429853 8:27491319-27491341 CCCACTGCGGCGGCGGCGCTGGG - Intronic
1039558410 8:38493647-38493669 CCCTCTGTGGAAGCAGGGAGGGG + Intergenic
1040444830 8:47483006-47483028 CCCACTGTGGAGGGGCAGAGGGG - Intronic
1043303344 8:78762462-78762484 TGCCCTGAGGAGGCGGGGAGGGG - Intronic
1047100162 8:121667532-121667554 CCCCCGGCGGGGGCGGGGCGGGG + Intergenic
1047785477 8:128150176-128150198 ACCACTGTGGTGGGGGGGAGTGG + Intergenic
1048268094 8:133005213-133005235 CACACTGCGCAGGAGGTGAGAGG + Intronic
1048967729 8:139626448-139626470 CCCACTGCAGTGGGGTGGAGTGG + Intronic
1049324341 8:142014335-142014357 CCCACGGCCAAGGCGGGGTGAGG - Intergenic
1057446083 9:95115888-95115910 CCCATTGTGAAGGCCGGGAGAGG - Intronic
1059453951 9:114388024-114388046 ACCACGGCAGGGGCGGGGAGAGG - Intronic
1062399252 9:136365285-136365307 CCCACTGCAATGCCGGGGAGGGG - Intronic
1062501824 9:136855029-136855051 CCTGCTGCGGAGGCGCCGAGGGG + Exonic
1062539152 9:137034081-137034103 CTCACTGTGGGGCCGGGGAGAGG - Intronic
1062653666 9:137590913-137590935 CCCTCTGGGCGGGCGGGGAGCGG + Intergenic
1186480743 X:9894858-9894880 GTCACTGCGGAGAGGGGGAGGGG - Exonic
1187348823 X:18493009-18493031 CCCACAGGTGAGGTGGGGAGGGG - Intronic
1189333471 X:40156461-40156483 CCCACGGTGCAGGCGGGCAGGGG - Intronic
1189348497 X:40260211-40260233 CACACAGAGGAGGCGGGGCGGGG - Intergenic
1190194573 X:48306053-48306075 TGCACCGCGGAGGAGGGGAGGGG + Intergenic
1190261734 X:48801959-48801981 TCGACGGCGGAGGCGGGAAGGGG + Intronic
1190300415 X:49053892-49053914 CCGCCTGCGGAGGAAGGGAGGGG + Intronic
1190667301 X:52707052-52707074 TGCACCGCGGAGGAGGGGAGGGG + Intronic
1190672117 X:52751356-52751378 TGCACCGCGGAGGAGGGGAGGGG - Intronic
1192251441 X:69417042-69417064 CCCACGGCGGGGGGGGGGAGAGG - Intergenic
1194743721 X:97606131-97606153 CCCACTGGGGAGTGGGGGTGGGG - Intergenic
1198705832 X:139447120-139447142 CGCGCTGCGGAGGCGCGGGGTGG - Intergenic
1199680693 X:150222326-150222348 GCCACTATGGAGGGGGGGAGGGG + Intergenic