ID: 1180997735

View in Genome Browser
Species Human (GRCh38)
Location 22:19973791-19973813
Sequence CCACTGCGGAGGCGGGGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180997724_1180997735 15 Left 1180997724 22:19973753-19973775 CCGCGCTCTTTGCGCACTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1180997735 22:19973791-19973813 CCACTGCGGAGGCGGGGAGAGGG 0: 1
1: 0
2: 4
3: 16
4: 286
1180997722_1180997735 16 Left 1180997722 22:19973752-19973774 CCCGCGCTCTTTGCGCACTGTGG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1180997735 22:19973791-19973813 CCACTGCGGAGGCGGGGAGAGGG 0: 1
1: 0
2: 4
3: 16
4: 286
1180997721_1180997735 23 Left 1180997721 22:19973745-19973767 CCGGCAGCCCGCGCTCTTTGCGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1180997735 22:19973791-19973813 CCACTGCGGAGGCGGGGAGAGGG 0: 1
1: 0
2: 4
3: 16
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180997735 Original CRISPR CCACTGCGGAGGCGGGGAGA GGG Exonic
900130362 1:1084778-1084800 CCTCTGCTGAGGCGGGAAGGTGG - Intronic
900415842 1:2534384-2534406 CCACTGCCTGGGCGGGGAGGGGG - Intergenic
900735743 1:4298399-4298421 GCCCTGCTGAGGAGGGGAGATGG + Intergenic
900987015 1:6078984-6079006 GCACCGTGGAGGTGGGGAGACGG + Intronic
902379145 1:16044562-16044584 CCTCGGCGGATGCGGGGACAGGG - Exonic
902609411 1:17588353-17588375 CCCCTGGGGAGGCTGGGAAAGGG + Intronic
902772846 1:18655749-18655771 CCACTGGGGAGACTTGGAGAGGG + Intronic
903649046 1:24911967-24911989 CCACTGCCAGGGAGGGGAGAGGG + Intronic
903807943 1:26018731-26018753 CCACTGCGGTGGCTGGGACCAGG - Intergenic
903813364 1:26046844-26046866 CCGCTGCGGGGGAGGGGAGAAGG - Intergenic
904170969 1:28592132-28592154 CCACAGAGGAGGCGGGGGGTGGG + Intronic
906294422 1:44640642-44640664 CCAGTGTGGAGGCAGGGAGTTGG - Intronic
907406992 1:54259679-54259701 CCACTGGGGAGGAGGGGCGTGGG + Intronic
908246895 1:62234455-62234477 TCACTGCAGAGGCTGGAAGAAGG - Intergenic
909514374 1:76490783-76490805 CCACTGGGAAGACGGGGAGTAGG - Intronic
910229736 1:84973931-84973953 CCACTGCTGGGGCTGGGGGAAGG - Intronic
910288384 1:85578039-85578061 TCCCAGCGGAGGCGGCGAGAAGG + Intronic
911089821 1:94009559-94009581 CACATGCGGAGGCTGGGAGACGG - Intronic
912745089 1:112239474-112239496 CCACTGGGGACTCCGGGAGATGG - Intergenic
912967775 1:114251281-114251303 CCAGTGCAGTGGCGGGGAGGAGG - Intergenic
913047836 1:115089221-115089243 CAAACGCGGAGGCGAGGAGAAGG - Intronic
913518640 1:119625164-119625186 GCACTGCGGAGGAGGGCAGCAGG + Intronic
915275674 1:154786711-154786733 CTACTGGGGACGCAGGGAGATGG + Intronic
915534245 1:156525278-156525300 CCACACCGGAGGCAGGCAGAGGG + Intergenic
916715084 1:167441287-167441309 GCACTGAGGAGGCAGGGAGTTGG - Intronic
919420604 1:197365491-197365513 CCTCTGGGGAGGGGGGGAGAAGG + Intronic
919767563 1:201136987-201137009 GCAGTGAGGAGGCTGGGAGAGGG + Intronic
919878697 1:201888708-201888730 CCACCGCGGAGCCGGGGACAGGG + Exonic
919895704 1:202008452-202008474 CCAGTGCGGGGGCGGGGGGGCGG + Exonic
922044253 1:221928281-221928303 CTTCTGCGGAGGAGAGGAGAGGG + Intergenic
922201380 1:223404417-223404439 CCAATGGGGAGGTGGGGAGGTGG - Intergenic
923731982 1:236560479-236560501 GCACAGCAGAGGAGGGGAGAAGG + Intronic
924736644 1:246763098-246763120 CCACTGCGGAGGAAGGAAGAAGG + Intronic
1062874850 10:934816-934838 CCACTGGGGGGACGGGGAGAAGG - Intergenic
1063179928 10:3588957-3588979 CCAATGCAGTGGCAGGGAGATGG + Intergenic
1063456362 10:6185458-6185480 CCACTGCGGGGGCGAGGAGACGG + Intronic
1064288105 10:14010449-14010471 TCCCTTGGGAGGCGGGGAGAAGG + Intronic
1070162287 10:73873860-73873882 CCACTGCAGGGGTGGGGGGAGGG + Intronic
1070573987 10:77663321-77663343 CAGCTGTGGAGGAGGGGAGAAGG - Intergenic
1073291388 10:102414944-102414966 CCACTGCCGAGGCTGGGATGAGG + Exonic
1074829865 10:117240958-117240980 CCGCGGCCGAGGCGGGGACAGGG + Intergenic
1076014359 10:127015689-127015711 CCACTATGGAGGGTGGGAGAGGG - Intronic
1076738897 10:132471389-132471411 CCACAGGGGAGGCTGGGAGGTGG + Intergenic
1076788060 10:132760903-132760925 CCACTGTAAACGCGGGGAGAGGG + Intronic
1077252972 11:1568760-1568782 CCTCTGAGGGGGCGGGGAGCCGG - Intronic
1077303496 11:1857564-1857586 CCACTGCTGGGGCGGCGGGAGGG + Intronic
1077420375 11:2447241-2447263 GCTCTGCGGAGGCTGGGCGAAGG - Intronic
1077554807 11:3220777-3220799 CCACTGCGGAGGGCAGGGGAGGG + Intergenic
1079756196 11:24267212-24267234 CCACTGTGGAGCAGGGGAGTAGG - Intergenic
1080489978 11:32751644-32751666 CCACTGCAGGGGCTGGGGGAGGG + Intronic
1082796601 11:57382421-57382443 CATCTGCGGGGGTGGGGAGAGGG - Intergenic
1083159198 11:60844191-60844213 CCCATGCAGAGGTGGGGAGAAGG + Intronic
1084118552 11:67055957-67055979 CCTCTGCGGGGGCGGGGTGGGGG + Intergenic
1084146770 11:67269184-67269206 CCACTGGGGCGGCGGGGGGCGGG - Intronic
1088849159 11:113690987-113691009 CCACTGCAGAGCCTGGGCGAAGG + Intronic
1089813717 11:121153297-121153319 CCACTGTGGAGGAGGGAGGAAGG - Intronic
1090256221 11:125286564-125286586 CCACTGAGGTTGCAGGGAGAAGG + Intronic
1090635504 11:128688263-128688285 ACAAAGCGGAGGCGAGGAGACGG + Intronic
1091224978 11:133951690-133951712 CCTCTGCCCAGGTGGGGAGAGGG - Intronic
1091393372 12:139099-139121 AGACGGCGGAGGTGGGGAGAGGG + Exonic
1092105992 12:5922123-5922145 CCACTCCAGAGGTGGGGAGGTGG + Intronic
1093921705 12:24866372-24866394 CCACAGCGGTGGCGGGGGGCGGG - Intronic
1095957067 12:47813102-47813124 CAAATGTGGAGGCGGGGAGCTGG - Intronic
1096178599 12:49538886-49538908 CCTCGGCGGGGGCGGGGAGGTGG - Intergenic
1097680333 12:62642958-62642980 CCACTACTGAGTTGGGGAGAAGG + Intergenic
1097848665 12:64390617-64390639 CCAGCGCGGGGGCGGGGAGAGGG - Exonic
1102024087 12:109703643-109703665 TCACAGTGCAGGCGGGGAGAGGG - Intergenic
1103935589 12:124474876-124474898 CTGCTGCGGGGGCGGGGAGGTGG - Intronic
1103982573 12:124746146-124746168 CCAGAGCGGAGGCTGGGGGAGGG - Intergenic
1104623600 12:130336559-130336581 CTACTCAGGAGGCTGGGAGACGG + Intergenic
1104823507 12:131692659-131692681 GTGCTGCGGAGGCGGGGAGGGGG + Intergenic
1107162101 13:37242150-37242172 CCAATGGGGAGGAGGGAAGATGG - Intergenic
1110064560 13:71087515-71087537 CCACTGCGCGGGCGGGGGGGGGG - Intergenic
1110098242 13:71559902-71559924 CCTCTCTGGAGGAGGGGAGAAGG - Exonic
1110126532 13:71950043-71950065 CCGCTGCAGAGGTGGGGAAAAGG - Intergenic
1111645146 13:91022992-91023014 TCAATGCAGAGGCGAGGAGAAGG + Intergenic
1111645329 13:91025259-91025281 TCAATGCAGAGGCGAGGAGAAGG - Intergenic
1111863986 13:93744986-93745008 CCACTGTGGAGGTGGAGAGGAGG - Intronic
1112440618 13:99422162-99422184 CCACTGGGGAGGGGGTGTGAAGG + Intergenic
1112507701 13:99985113-99985135 CCACCGCGGCGGCCGGGAGGAGG + Intronic
1112632548 13:101178573-101178595 CCTCTACGGAGAAGGGGAGACGG - Intronic
1113382822 13:109819165-109819187 CCTAGGCGAAGGCGGGGAGAAGG - Intergenic
1113779751 13:112969270-112969292 GCGCGGCGGAGGCGGGGAGGGGG - Exonic
1113942418 13:114025132-114025154 TCACTGCTGAGGCCCGGAGAAGG - Intronic
1114557003 14:23567825-23567847 CCGTGGTGGAGGCGGGGAGAGGG - Exonic
1115641769 14:35339815-35339837 CCACTGGGAAGGCTGGGAGCTGG - Intergenic
1118339150 14:64880002-64880024 CCGCGGCGGGGGCGGGGAGGCGG + Intergenic
1119510528 14:75207649-75207671 CTGCTGCGGAGGTGGGGAAAAGG + Intergenic
1122261853 14:100528092-100528114 TCATTGTGGAGGTGGGGAGATGG + Intronic
1122789857 14:104179589-104179611 CAACTGGGGAGGGGAGGAGAGGG - Exonic
1123048162 14:105528304-105528326 CCAGTGCGGCGGCGGGGAGAGGG + Intronic
1125541140 15:40470916-40470938 CCACGCCGGGGGCGGGGAGAGGG - Intergenic
1125568382 15:40695084-40695106 GCAGGGCGGAAGCGGGGAGAAGG + Intronic
1125956364 15:43793418-43793440 CCAGTGAGGAGGTTGGGAGAAGG - Intronic
1128028939 15:64462100-64462122 GCACTGAGGAGCCTGGGAGATGG - Intronic
1129104485 15:73296663-73296685 CCACTGCGGGGGGAGGGGGAGGG - Intronic
1129450451 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG + Exonic
1131456494 15:92586147-92586169 CCCCTGCAGAGGCTGGGGGAAGG + Intergenic
1131510036 15:93044736-93044758 ACACTGCAGGGGCGGGGCGAGGG + Intronic
1131512404 15:93056588-93056610 CTACAGAGGAGTCGGGGAGACGG - Intronic
1132641581 16:980803-980825 CGCCTGCGGAGGCGGGGAGAGGG - Intronic
1132683397 16:1152879-1152901 CCAGTGCGGGGGCGTGGAGGGGG + Intergenic
1132929452 16:2451427-2451449 GCACAGCTGAGGAGGGGAGACGG - Intronic
1134683701 16:16144157-16144179 CCACTGCGGGAGCTGGGAAATGG + Intergenic
1135727975 16:24871863-24871885 TCACTGCTGAGGAGGGGAGGGGG + Intronic
1136109199 16:28054108-28054130 CCACGGGGGAGGAGGGGAGGAGG - Intronic
1137684087 16:50373851-50373873 CCACAGTGGTGGCGGGGCGAGGG + Intergenic
1141642809 16:85351155-85351177 CTACAGAGGAGGCCGGGAGATGG + Intergenic
1141696713 16:85623736-85623758 CAGCTTCAGAGGCGGGGAGATGG - Intronic
1142805340 17:2368442-2368464 CCTCTGCAGGGGCGGGGAAAGGG - Intronic
1143018454 17:3904171-3904193 CCAGGGCGGAGGAGGGGAGACGG + Intronic
1143515613 17:7417844-7417866 CCACTCCGAAGGCAGGGAGGAGG + Exonic
1144109998 17:12021459-12021481 CCACTGCGGCGGCGGGGCCGAGG - Intronic
1145791610 17:27631247-27631269 CCACAGAGGCGGCGGAGAGATGG + Exonic
1147662725 17:42125668-42125690 CCACTGGGGGGGCAGGGGGAGGG - Exonic
1148774559 17:50088205-50088227 GCACTGCGGAGGGGAGGAGGTGG - Intronic
1148847555 17:50538214-50538236 CCACTGCGGTGGGGAGGGGATGG + Intronic
1148871409 17:50660651-50660673 GCACTGGGGAGGCGGGGAGAGGG + Intronic
1148892849 17:50820351-50820373 CCAGTGAGGAGCCGGGGGGAAGG - Intergenic
1148911853 17:50947152-50947174 CTACTGAGCAGGTGGGGAGAGGG + Intergenic
1150143566 17:62750155-62750177 GCACAGCGCAGTCGGGGAGAGGG - Intronic
1150351028 17:64444570-64444592 GAACTGGGGAGGCGGGGAGGCGG + Intergenic
1151414128 17:73950612-73950634 CCACCGTGGAGGCGGGGACCCGG + Intergenic
1152603529 17:81277545-81277567 CCTGTGCGGAGGCGCCGAGATGG - Intronic
1152687259 17:81700729-81700751 GGACTGCGGAGGCTGAGAGATGG - Exonic
1153770902 18:8415850-8415872 CCACTGGGAAGGCAGGGAGTGGG - Intergenic
1154954785 18:21242790-21242812 CCCCGGCGGAGGCGGCGAGGGGG + Intronic
1157364019 18:47047029-47047051 CTACTGGGGAGGCTGGGAGCAGG - Intronic
1157626515 18:49055459-49055481 CTACTTAGGAGGCTGGGAGAAGG + Intronic
1158225215 18:55193801-55193823 CCACTGGGGAGGCTGGTAAAGGG + Intergenic
1160662183 19:306305-306327 TCACTGCCCCGGCGGGGAGACGG - Exonic
1160979861 19:1811971-1811993 CCCCTGCGGCTGCGGGAAGACGG - Intronic
1161118342 19:2511843-2511865 CCCCTGGGGAGGGTGGGAGAGGG + Exonic
1161384869 19:3985525-3985547 GCGCTGCGAAGGCGGGGCGAAGG + Intergenic
1163463856 19:17455136-17455158 CCACTCCGGAGGTGGAGAGCTGG - Intronic
1163702142 19:18791266-18791288 CCATGGCGGTGGCGGGGAGCTGG + Exonic
1165326039 19:35115260-35115282 CCACCGTGGGGGCGGGGAGGAGG - Intergenic
1165360899 19:35336387-35336409 CCCCTGCGGGGCTGGGGAGAAGG - Intronic
1166323736 19:42036463-42036485 CCACTCAGGAGGCTGGGAGGTGG - Intronic
1167127453 19:47559928-47559950 CCACTGCTGAGCCAGGGAGTAGG - Intergenic
1167131327 19:47588004-47588026 CCAGTGTGGAGGCGTGGGGATGG - Intergenic
1167134294 19:47608240-47608262 CCACGGCGGCGCCGGGGAGGCGG - Exonic
1167587685 19:50384205-50384227 CCACTTCGGAAGCTGAGAGAGGG + Intronic
1168281498 19:55308503-55308525 CCCCAGCGGAGCAGGGGAGACGG + Intronic
1168694336 19:58396254-58396276 CCACCGGGGAGGCGGGGGGCAGG - Exonic
926880532 2:17539791-17539813 CCAATGGGGAGCCGGGGGGAGGG + Intronic
927472276 2:23385407-23385429 CCGCCGCGGCTGCGGGGAGAGGG + Exonic
927554083 2:24020442-24020464 CCTCTGGGGAGGGGAGGAGAGGG - Intronic
927563653 2:24092111-24092133 CTACTTGGGAGGCTGGGAGATGG + Intronic
928355754 2:30613241-30613263 CCACTGGGGAGAAGGGGTGAAGG + Intronic
928364863 2:30692615-30692637 CCAATGCCGAGGCAGGGAGTGGG + Intergenic
930198368 2:48530352-48530374 CCAGGGCGGGCGCGGGGAGATGG - Intronic
930667658 2:54115626-54115648 CGACTGCGGCGGCTGCGAGAGGG - Exonic
930825654 2:55694233-55694255 CCAGGGCGGAGAAGGGGAGAAGG - Intergenic
934708393 2:96500396-96500418 CCGCAGGGGAGGTGGGGAGATGG - Intronic
935038655 2:99404314-99404336 CCACTGGGGAGGGGAGGGGAGGG - Intronic
935349683 2:102142695-102142717 CCGCTGCGGGGGCGGGGAACGGG - Intronic
936939638 2:117871061-117871083 CGGCGGCGGCGGCGGGGAGAGGG - Intergenic
938084593 2:128390495-128390517 CCACCCTGGAGGCGTGGAGAGGG + Intergenic
939586243 2:144009350-144009372 TCACTGTGGAGACAGGGAGAGGG + Intronic
942015147 2:171805996-171806018 CTACTGGGGAGGCTGAGAGATGG + Intronic
942171269 2:173291772-173291794 CCACTCCTGAGGCGGGGGGGGGG - Intergenic
943669646 2:190648297-190648319 CCAGAGCGGAGGTGGGGAGGGGG + Intronic
946231706 2:218295536-218295558 CCTATTCGGAGGAGGGGAGAAGG + Intronic
947068674 2:226260849-226260871 ACAATGCAGATGCGGGGAGAGGG + Intergenic
947545644 2:231008464-231008486 CCACTGGGAAGGCAGGGAGCTGG + Intronic
947992137 2:234496608-234496630 CCACTGCGGCTGCGGCGGGAGGG + Exonic
948681169 2:239635593-239635615 CCACTCAGGGGGTGGGGAGATGG - Intergenic
948995920 2:241578612-241578634 CCATTACGGAGGCCAGGAGATGG - Intergenic
1168753186 20:297933-297955 GCGCTGCGGAGGCGGGCAGGAGG + Exonic
1168939217 20:1694889-1694911 CCATAGGGGAGGTGGGGAGAGGG - Intergenic
1169391735 20:5196356-5196378 CCACTGCTGGGCCGGGGAGGGGG + Exonic
1171012042 20:21514112-21514134 AACCTGGGGAGGCGGGGAGAGGG + Intergenic
1172026293 20:31951324-31951346 CAAGGGCGGAGGCAGGGAGATGG - Intronic
1174342488 20:49906532-49906554 GCCCTGCGGCGGCGGGCAGAGGG - Exonic
1174503779 20:51003962-51003984 CCACTGCAGACGCCTGGAGAGGG - Exonic
1175091354 20:56507234-56507256 CTACTGCGGAGATGGGGAGTGGG - Intronic
1175216230 20:57392856-57392878 CCACTGCTGGGGCGAGGAGGGGG - Intronic
1175552202 20:59824774-59824796 CCAGTGGGGGGGCGGGGGGAGGG + Intronic
1176545700 21:8197094-8197116 GCACCCCTGAGGCGGGGAGAGGG - Intergenic
1176564651 21:8380139-8380161 GCACCCCTGAGGCGGGGAGAGGG - Intergenic
1178263856 21:31124469-31124491 CTACTGCGGAGTGGGGGTGACGG + Intronic
1178916698 21:36709021-36709043 CGGCTGCGGAGCCGGGGAGGCGG + Intronic
1179610060 21:42544609-42544631 CCTCTGCAGAAGCGGGGAAAGGG - Intronic
1179833333 21:44012143-44012165 CCACTGCCGAGGGAGGAAGATGG + Intergenic
1180164757 21:46019167-46019189 CCACTTGGGAGGCTGGGGGAGGG - Intergenic
1180590224 22:16930876-16930898 CCACTCCAGAGGCTGGGACAGGG + Intergenic
1180958449 22:19751481-19751503 CCAGTGGGGAAGCCGGGAGAGGG + Intergenic
1180997735 22:19973791-19973813 CCACTGCGGAGGCGGGGAGAGGG + Exonic
1181051598 22:20240621-20240643 CCACTGCCCTGGCGGGGAGGGGG + Intergenic
1182319696 22:29470536-29470558 CCACTGCGGAAGGGCGGGGATGG + Intergenic
1182520131 22:30880484-30880506 TCACGGAGGAGGTGGGGAGATGG - Intronic
1183264217 22:36815784-36815806 CCACTTCGGAGGCAGTGGGAAGG + Intronic
1183281060 22:36932934-36932956 ACACTGGGGAGGGCGGGAGAAGG + Intronic
1183329759 22:37212830-37212852 CCACTGGGGAGGCCGGGTGGGGG + Intergenic
1183437729 22:37805046-37805068 CCAGGGCGGCGGCGGGGAGCAGG + Intergenic
1184486532 22:44783293-44783315 CCGCTGCGGGGGTGGGGAGGGGG - Intronic
1184644175 22:45887168-45887190 CCACTGGAGAGTCAGGGAGATGG + Intergenic
1203250571 22_KI270733v1_random:113331-113353 GCACCCCTGAGGCGGGGAGAGGG - Intergenic
950457872 3:13103369-13103391 CCACAGAGGTGGAGGGGAGAGGG - Intergenic
950509252 3:13415912-13415934 CCCCTGCTGGGGCAGGGAGAGGG + Intronic
951992554 3:28691854-28691876 GCAGTGGGGAGGCGGGGAGCAGG + Intergenic
953223671 3:40997815-40997837 CCACTGCAGAGGTGGGGGGGTGG - Intergenic
953822734 3:46222254-46222276 CCATGGTGGAGGTGGGGAGATGG + Intronic
954131354 3:48562773-48562795 CCACTGCTGAGCCTGAGAGAGGG - Exonic
954441645 3:50525442-50525464 GCACAGCAGAGGCGGGGGGAGGG + Intergenic
954622108 3:52002247-52002269 CCACTTCACAGGTGGGGAGATGG + Intergenic
954654308 3:52184674-52184696 CCACAGAGGAGGCAGGCAGAGGG + Intergenic
955954561 3:64275298-64275320 GCACTGGGGCGGCGGGGGGAGGG + Intronic
956745923 3:72311019-72311041 CACCTGCGGAGGTGGGGCGATGG - Intergenic
957459461 3:80497748-80497770 CCACAGCGGGTGCTGGGAGAGGG + Intergenic
962695854 3:137946498-137946520 CCTTTGCGGGGGCGGGGCGAAGG + Intergenic
964482745 3:157159378-157159400 GCACAGCGGAGGCGGGTAAAAGG - Intronic
966096755 3:176213504-176213526 CCACTGCGGGGGCCGGGGGAAGG + Intergenic
966560062 3:181310066-181310088 TCACTGGGGGGGTGGGGAGAGGG - Intergenic
966686003 3:182696324-182696346 CTACTCAGGAGGCTGGGAGATGG + Intergenic
966975393 3:185078586-185078608 CCACTGAGGAGGAGGGAAGAAGG - Exonic
968035308 3:195543352-195543374 CTAGGGAGGAGGCGGGGAGAGGG + Exonic
969318235 4:6394999-6395021 CCAGGGCGGAGGCAGGGAGGTGG - Intronic
969410591 4:7025488-7025510 CCACTGCAGAGGAGGTGGGAAGG - Intronic
969828618 4:9778112-9778134 ACTCGGGGGAGGCGGGGAGAAGG - Intronic
970006823 4:11418966-11418988 GCTCTGCTGAGGCAGGGAGAGGG + Intronic
971372456 4:26029594-26029616 TCACTGCGGAGGCAGGGATATGG + Intergenic
973715856 4:53675210-53675232 GCACTGCGGTGGCAGGAAGAAGG - Intronic
975640929 4:76499667-76499689 CCACTGGGGAGGAGGGGACATGG + Intronic
980841413 4:138265991-138266013 CCACTGGGGAAACGGTGAGAAGG - Intergenic
981442546 4:144799451-144799473 CCACTGTGGGGGATGGGAGATGG + Intergenic
981492280 4:145352462-145352484 TCAGTGCTGAGGCTGGGAGAAGG + Intergenic
983891913 4:173038314-173038336 CCACAGCAGCGGCTGGGAGAGGG + Intronic
983904565 4:173169585-173169607 CAACTCCGGCGGCGGGGAGCCGG + Intronic
983937287 4:173510756-173510778 CGACTGCGGAGGCGGGATGGAGG - Intergenic
984908298 4:184649516-184649538 CCGCAGCGGAGGCGGCGCGAGGG - Intergenic
985250158 4:188015981-188016003 CTACTTCGGAGGCTGGTAGAAGG + Intergenic
985551406 5:535244-535266 CCCCTGGGGAGGCGGGGGCAAGG - Intergenic
988941439 5:36151908-36151930 CCACGGGGTAGGCGGGGAGGCGG - Exonic
990978977 5:61584758-61584780 CCACTGGGCAGGTAGGGAGAGGG - Intergenic
999133093 5:149299489-149299511 GCACTGCGGAGGAAGGCAGACGG - Exonic
999732358 5:154484094-154484116 CCACTGCGAGGGATGGGAGAAGG - Intergenic
1001919867 5:175591324-175591346 CCACTGGTGAGGCGGTGAGGGGG - Intergenic
1002069779 5:176672297-176672319 GCAGTGGGGAGGCGAGGAGATGG + Intergenic
1002691341 5:181052889-181052911 CGCCTGCGGACGCGGGGCGAGGG + Intronic
1004396400 6:15249022-15249044 CCACTTGGGAAGCGGGGAGCGGG + Intronic
1004978674 6:20997529-20997551 CCACGGGGGTGGCGGGGGGAGGG + Intronic
1005987709 6:30884639-30884661 CCTCTTCGGCGGCGGGGCGAGGG - Intronic
1006448742 6:34093779-34093801 CCACAGGGGAGGCGGAGAGCGGG - Intronic
1007832288 6:44647660-44647682 CCCCTGGGGAGGGGTGGAGAAGG - Intergenic
1008816902 6:55579193-55579215 GCACTGCGGCGGCGCCGAGAGGG + Intronic
1013063783 6:106662811-106662833 CCACTGGGGAGCCAGGGGGAAGG + Intronic
1013082055 6:106821628-106821650 ATTCTGGGGAGGCGGGGAGAAGG - Intergenic
1018935355 6:168270703-168270725 CCACTCGGGAGGCTGTGAGATGG - Intergenic
1019488551 7:1300582-1300604 CCCCTGCAGAGGCTGGGAGCAGG - Intergenic
1019622118 7:1997700-1997722 CCAGTGCGGTGGCGGGGGGCAGG + Intronic
1020237778 7:6369885-6369907 CCACTGGGGAGGAGGGTGGAGGG - Intergenic
1020256072 7:6503758-6503780 GCAGGGCAGAGGCGGGGAGAGGG + Intronic
1022347058 7:29526899-29526921 CCACTGGGGAAGCAGGGTGAAGG - Intergenic
1022412290 7:30148590-30148612 TCACGGCAGAGGCGGGGTGAGGG + Intronic
1022961526 7:35430654-35430676 GCTCTGAGGAGGCGGGGAGGAGG - Intergenic
1023306010 7:38827600-38827622 CCACTGCCAAGATGGGGAGAGGG + Intronic
1023783703 7:43684133-43684155 CCACAGAGGAGGCAGGGGGATGG + Intronic
1023986867 7:45101957-45101979 CCACAGCCGAGGCAGGCAGAAGG + Exonic
1029272348 7:99384751-99384773 ACACTGCTCAGACGGGGAGAAGG - Intronic
1029274219 7:99394520-99394542 CTGCTGGGGAAGCGGGGAGAGGG + Exonic
1029482197 7:100819926-100819948 GCTCTGCGGTGGTGGGGAGAGGG + Intronic
1029494088 7:100887998-100888020 TTACTGCGGGGGCGGGGAGGGGG - Intronic
1029494506 7:100889773-100889795 GCACGGCGGAGGGGAGGAGAGGG - Intergenic
1030293087 7:107891409-107891431 CCAGTGCAGAGGCGGGGCCAGGG - Intronic
1030304482 7:108004217-108004239 CAAATGCTGAGGTGGGGAGAGGG + Intergenic
1037362139 8:18084583-18084605 CCACCGCGGAGTCAGGGACAAGG + Intronic
1037815667 8:22110335-22110357 CCAGTGCTGAGGTGGGGTGAAGG - Intergenic
1038168932 8:25111027-25111049 CCACTGCTGCAGTGGGGAGATGG + Intergenic
1042962790 8:74321227-74321249 CTACTGCGGCGGCTGGGAGGAGG - Exonic
1043058256 8:75467547-75467569 CTACTGGGGAGGCTGAGAGAGGG + Intronic
1046633622 8:116647178-116647200 GAACTGGGGAGGCGGGGAGGCGG - Intronic
1048511608 8:135067526-135067548 CCACTGCAGGGGTGGGGTGAAGG - Intergenic
1049378240 8:142299186-142299208 CCACAGCAGAGGCAGGGAGGTGG + Intronic
1049435470 8:142584292-142584314 CCAGTGGGGTGGCGGGGGGAGGG - Intergenic
1049441707 8:142612617-142612639 GCTCTGCGGATGCCGGGAGAGGG + Exonic
1053266026 9:36714279-36714301 CCACTGCGGAAGGCCGGAGACGG + Intergenic
1056922239 9:90801490-90801512 CCACCGCGCTGGCGGGGAGGAGG + Intergenic
1057446081 9:95115887-95115909 CCATTGTGAAGGCCGGGAGAGGG - Intronic
1057739175 9:97697070-97697092 GGACCGGGGAGGCGGGGAGAGGG + Intronic
1057996443 9:99824402-99824424 CCATTGAAGATGCGGGGAGACGG + Intronic
1061230525 9:129313257-129313279 CTACTGCGGAGGCAGGAGGATGG + Intergenic
1061440720 9:130601515-130601537 CCACTGGGGTGGCGGGGGTAAGG + Intronic
1061631840 9:131876994-131877016 CCATTTAAGAGGCGGGGAGATGG + Intronic
1061777191 9:132973346-132973368 CCACTGCTGAGGCCGGGCCACGG - Intronic
1061963927 9:134002875-134002897 GCACTGGGGAGGCCAGGAGATGG - Intergenic
1062021457 9:134321369-134321391 CCTCTGCGGCGGCGAGGAGATGG - Intronic
1062050357 9:134443853-134443875 TCACTTTGGAGGTGGGGAGATGG - Intergenic
1062085031 9:134643923-134643945 ACAGTGTGGAGGTGGGGAGATGG - Intronic
1062120468 9:134831419-134831441 GCACAGAGGAGGCGGGGAAAAGG - Intronic
1062266099 9:135687252-135687274 CCACTTGTGAGGCGGGGAGGAGG - Intergenic
1062606137 9:137349654-137349676 CCACAGCAGAGACGGGGAGAAGG + Intronic
1203466973 Un_GL000220v1:96603-96625 GCACCCCTGAGGCGGGGAGAGGG - Intergenic
1186480742 X:9894857-9894879 TCACTGCGGAGAGGGGGAGGGGG - Exonic
1189824066 X:44898979-44899001 AAACTGCGGAGGGAGGGAGAGGG + Intronic
1190261735 X:48801960-48801982 CGACGGCGGAGGCGGGAAGGGGG + Intronic
1192214589 X:69149928-69149950 CCACAGCGGCGACAGGGAGAAGG + Intergenic
1192224990 X:69221835-69221857 CCACAGCGGCGACGCGGAGAAGG - Intergenic
1192251439 X:69417041-69417063 CCACGGCGGGGGGGGGGAGAGGG - Intergenic
1195753370 X:108178442-108178464 CCATGGAGGAGGCGGGGGGAGGG + Intronic
1197765400 X:130056740-130056762 CCACTGGGGAGGGGGTGAGGTGG + Exonic
1197765567 X:130057435-130057457 CCACAGAGGGGGCGGGGACAGGG - Exonic
1197942116 X:131801434-131801456 GCACTGTGGAGGCTGGGGGATGG + Intergenic
1198807905 X:140507720-140507742 CCATTGCGGGCGTGGGGAGATGG + Intergenic
1199687195 X:150274897-150274919 CCAGTGAGGAGCTGGGGAGAAGG + Intergenic
1200035081 X:153321476-153321498 CCACTGCGGAGGCAGCGATCTGG + Intergenic