ID: 1181000426

View in Genome Browser
Species Human (GRCh38)
Location 22:19985467-19985489
Sequence GGGGCCCAGAGCCCCTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181000426_1181000433 13 Left 1181000426 22:19985467-19985489 CCAGCATAGGGGCTCTGGGCCCC 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1181000433 22:19985503-19985525 GGCTCAGCTTCTTCACAAGGAGG 0: 1
1: 0
2: 1
3: 18
4: 250
1181000426_1181000434 21 Left 1181000426 22:19985467-19985489 CCAGCATAGGGGCTCTGGGCCCC 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1181000434 22:19985511-19985533 TTCTTCACAAGGAGGTGAGAAGG 0: 1
1: 0
2: 6
3: 74
4: 615
1181000426_1181000432 10 Left 1181000426 22:19985467-19985489 CCAGCATAGGGGCTCTGGGCCCC 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1181000432 22:19985500-19985522 TTCGGCTCAGCTTCTTCACAAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1181000426_1181000435 28 Left 1181000426 22:19985467-19985489 CCAGCATAGGGGCTCTGGGCCCC 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1181000435 22:19985518-19985540 CAAGGAGGTGAGAAGGACAGAGG 0: 1
1: 1
2: 1
3: 79
4: 621
1181000426_1181000437 30 Left 1181000426 22:19985467-19985489 CCAGCATAGGGGCTCTGGGCCCC 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1181000437 22:19985520-19985542 AGGAGGTGAGAAGGACAGAGGGG 0: 1
1: 1
2: 15
3: 140
4: 1349
1181000426_1181000427 -8 Left 1181000426 22:19985467-19985489 CCAGCATAGGGGCTCTGGGCCCC 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1181000427 22:19985482-19985504 TGGGCCCCATCACGCACCTTCGG 0: 1
1: 0
2: 1
3: 7
4: 64
1181000426_1181000436 29 Left 1181000426 22:19985467-19985489 CCAGCATAGGGGCTCTGGGCCCC 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1181000436 22:19985519-19985541 AAGGAGGTGAGAAGGACAGAGGG 0: 1
1: 0
2: 6
3: 158
4: 1596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181000426 Original CRISPR GGGGCCCAGAGCCCCTATGC TGG (reversed) Intronic
900391457 1:2435762-2435784 GGGGTCCAGAGCCCCTGCGATGG + Intronic
900402847 1:2479675-2479697 GGGGCCCAGCGTCCCCCTGCTGG - Intronic
900778373 1:4601059-4601081 GGGGCCGAGAGCCACGCTGCTGG - Intergenic
901233669 1:7655856-7655878 GGAGGCCTGAGCCCCCATGCGGG + Intronic
901400960 1:9014916-9014938 TGGGCCCCAAGCCCCCATGCTGG + Intronic
901631158 1:10648862-10648884 GGGGCTCTGAGCCCCTGTCCAGG - Intronic
903338892 1:22642256-22642278 GGAGCCCAGAGCCGTTAGGCTGG + Intergenic
903370990 1:22836097-22836119 GGGCCCCCGAGCCCCTGGGCCGG - Intronic
904438068 1:30512308-30512330 TGGTCCCAGAGGCCCTGTGCAGG + Intergenic
904882521 1:33711753-33711775 GGGGCACATAGCTCTTATGCAGG - Intronic
905922191 1:41727250-41727272 GGGGCCCAGAGAGGCTAAGCAGG + Intronic
906635783 1:47409583-47409605 TGGGCCAAGACCCCCCATGCGGG - Intergenic
909108003 1:71436963-71436985 GAGGCCCTAAGCCCCTATGCAGG - Intronic
913381023 1:118210132-118210154 AAAGCCCAGAGCCCCTTTGCAGG - Intergenic
915409468 1:155689001-155689023 GCGGCCTAGCGCCCCTCTGCCGG + Intronic
917200928 1:172514627-172514649 GGGGACCAGAGTGCCTTTGCAGG + Intergenic
920398536 1:205663087-205663109 GGGGCCGACAGCCCTTCTGCTGG + Exonic
922783272 1:228269859-228269881 GGGCCCCAGGGCCCCTTTGCCGG + Intronic
1062961406 10:1576020-1576042 GGGGCCCAGGGCCACTCGGCGGG + Intronic
1063995192 10:11611865-11611887 GGTGCCCGGAGCCCCTCGGCGGG + Intergenic
1067847371 10:49735121-49735143 GGGCCCCACAGCCCCTCTCCTGG + Exonic
1069070710 10:63988209-63988231 AGAACCCAGAGCCCATATGCAGG + Intergenic
1074814414 10:117133915-117133937 GGTGCCCAGAGCTCCTGCGCTGG - Exonic
1076495028 10:130891348-130891370 GGGGGCCAGGGAGCCTATGCCGG - Intergenic
1076525261 10:131108693-131108715 GGAGCCCAATGCCCCCATGCTGG - Intronic
1076731253 10:132440285-132440307 TGGGCCCAGATCCCGTGTGCTGG - Intergenic
1076731271 10:132440349-132440371 TGGGCCCAGATCCCGTGTGCTGG - Intergenic
1076731289 10:132440416-132440438 TGGGCCCAGATCCCGTGTGCTGG - Intergenic
1076731307 10:132440483-132440505 TGGGCCCAGATCCCGTGTGCTGG - Intergenic
1076731330 10:132440551-132440573 TGGGCCCAGATCCCGTGTGCTGG - Intergenic
1076731342 10:132440585-132440607 TGGGCCCAGATCCCGTGTGCTGG - Intergenic
1076731360 10:132440649-132440671 TGGGCCCAGATCCCGTGTGCTGG - Intergenic
1076731381 10:132440718-132440740 TGGGCCCAGATCCCGTGTGCTGG - Intergenic
1077014314 11:393142-393164 GGGCCTCAGAGCCCATTTGCTGG + Intronic
1077204401 11:1335571-1335593 TGGGCCCGGGGCCCCCATGCAGG + Intergenic
1077284768 11:1760756-1760778 GTGGGCCAGAGCCCCGAGGCTGG + Intronic
1077477434 11:2797121-2797143 TCGGCCCAGAGCCTCGATGCCGG + Intronic
1078143668 11:8709007-8709029 CAGGCCCGGAGCCCCCATGCAGG + Intronic
1083764046 11:64833699-64833721 GGGGCCCAGGCCCCCTACGATGG + Intronic
1084273426 11:68040543-68040565 AGGGCCCAGGGCCCCTCTGTGGG - Intronic
1085123699 11:73983248-73983270 TGGGCCCAGCCCCCCTACGCTGG + Exonic
1085307416 11:75495838-75495860 GGGGCCTAGACCCCCTGTGCTGG + Intronic
1091231047 11:133988295-133988317 GGTGCCCAGAGCCCAGGTGCTGG - Intergenic
1091587037 12:1822373-1822395 GGGGCAGACAGCCTCTATGCTGG - Intronic
1091697248 12:2636203-2636225 GGGGCCGAGAGCCCCACAGCAGG + Intronic
1092108670 12:5944004-5944026 GGGTACCAGAGCCACTCTGCTGG - Intronic
1095234055 12:39776281-39776303 GGGCCCCACAGCTCCTAAGCGGG - Intronic
1097522779 12:60689397-60689419 TGGGCCCAGGGTCCCTCTGCTGG - Intergenic
1098181432 12:67850830-67850852 GGGTCCCTGAGCCACCATGCAGG + Intergenic
1102720638 12:115013295-115013317 GGAGCCCAGAGACCCTGGGCTGG - Intergenic
1110555181 13:76851791-76851813 TGGGCTGAGAGCTCCTATGCTGG - Intergenic
1112339112 13:98537908-98537930 GGAGCCCTGAGCCCCTCAGCAGG - Intronic
1113124129 13:106957735-106957757 GAAGCCCAGAGGCCCTATGGAGG + Intergenic
1114278754 14:21170482-21170504 TGGGCCCACAGCCCCCATTCAGG + Intergenic
1120171040 14:81247532-81247554 GCAGCCAAGAGCCCATATGCCGG - Intergenic
1120840539 14:89081357-89081379 GAGGCTCAGAGCCCCTCTGATGG - Intergenic
1120925579 14:89793991-89794013 AGGGGCCAGAGCCTCTATGTGGG + Intergenic
1120942218 14:89959350-89959372 GGGCACCAGAGCCTCTATGAGGG + Intronic
1122232360 14:100313096-100313118 GGGGCCGGGAGCCCCACTGCGGG - Intergenic
1122693371 14:103541767-103541789 TGGGCCCAGAGCTCCTTAGCAGG - Intergenic
1122786241 14:104164462-104164484 GGCACCCAGAGCCCCTACCCCGG - Intronic
1122976017 14:105171073-105171095 TGGGCCCAGAGCCCCTGGCCAGG - Intergenic
1124101327 15:26696745-26696767 GGGTCCCTGAGACCCTCTGCAGG - Intronic
1124725242 15:32150729-32150751 GGAGCCCTGAGACCCTATGGAGG - Intronic
1125511848 15:40296447-40296469 GGGGCCCAAGGCCCCCATCCAGG + Intronic
1128067269 15:64773273-64773295 TGGGCCATGAGCCCCTGTGCTGG - Intronic
1128130490 15:65224038-65224060 GGAAACCTGAGCCCCTATGCCGG - Intergenic
1129179354 15:73862473-73862495 GGCGCCCAGAGGCCCTTTTCCGG - Intergenic
1131531777 15:93199932-93199954 GGAGCCCAAAGCCACTATGGTGG + Intergenic
1133284517 16:4684334-4684356 TGGGCCCACAGGCCCCATGCTGG + Intronic
1133795127 16:9040133-9040155 GGGGAGCAGATCCCCTAAGCTGG + Intergenic
1134569492 16:15279308-15279330 GGGGCCCAGAGAACCAATGAGGG - Intergenic
1134732885 16:16476741-16476763 GGGGCCCAGAGAACCAATGAGGG + Intergenic
1134934555 16:18235230-18235252 GGGGCCCAGAGAACCAATGAGGG - Intergenic
1135340975 16:21647733-21647755 GGGGAACAGAGTCCCTGTGCAGG + Intronic
1137622140 16:49883128-49883150 GGGGCACAGAGCCCCAATGATGG - Intergenic
1137881820 16:52057333-52057355 GGGACCAAGAGGCCATATGCAGG - Intronic
1138460176 16:57143354-57143376 GGGGCCCAGAGCCCTGGTACTGG - Intronic
1138656363 16:58493934-58493956 GGGGCCCACAGACACTCTGCGGG - Intronic
1138771586 16:59670999-59671021 GGGGCCTAGACCACCTTTGCAGG - Intergenic
1140535783 16:75708276-75708298 GGAACCCAGTGCCCCTGTGCAGG + Intronic
1140802302 16:78499581-78499603 CTGGCCCAGGGCCCCTTTGCCGG + Intronic
1141627924 16:85271216-85271238 GGGTCCCAGAGCCCCCAAGCAGG + Intergenic
1141978777 16:87536371-87536393 GGGCCCTTGAGCCCCTATGCCGG - Intergenic
1141994571 16:87628303-87628325 AGGGGCCAGAGCCCCCATGCTGG + Intronic
1142351778 16:89583948-89583970 GGGGACCAGAGGCCCCAGGCTGG - Intronic
1145041319 17:19579996-19580018 AGGGCCCGGAGCCGCTATGGGGG - Intergenic
1146645661 17:34575832-34575854 TGTTCCCAGAGCCCCTGTGCTGG + Exonic
1147170717 17:38617251-38617273 GGGGCTCAGAGCCCAGATGGGGG + Intergenic
1147218545 17:38914852-38914874 GGGGCTCAGAGCCCCTGCGTGGG + Intronic
1147324217 17:39662712-39662734 CTGGCCCAGAGCCCCCCTGCTGG + Intronic
1148354647 17:46967835-46967857 GGGGCCCAGAGACCATTTGGGGG + Intronic
1150210581 17:63439082-63439104 GGGGGTCAGTGCCCCTGTGCTGG - Intronic
1151554106 17:74837905-74837927 GGAGCCCAGAGCCCCTGGCCTGG + Exonic
1151656376 17:75498126-75498148 GGGGCGCACAGCCCCTCTGCCGG - Intronic
1151716213 17:75832440-75832462 GTGGTCCAGAGCCCATGTGCTGG + Intronic
1151817287 17:76477540-76477562 GGGACCCAGAGGCCCACTGCTGG - Intronic
1152091699 17:78250952-78250974 GGGGCCCAGTGCCCCCCAGCTGG - Intergenic
1152759269 17:82099516-82099538 GGGGCCCCCGGCCCCTCTGCAGG + Intergenic
1152821323 17:82439240-82439262 GGGGCCCGGAGGCCCTAGGAGGG + Intronic
1155197717 18:23490401-23490423 GGGGCCCACAGTCCCCAGGCAGG - Intergenic
1160190928 18:76713470-76713492 GGGGCCCACAGCCCCTGCCCAGG + Intergenic
1160618078 18:80148957-80148979 GGGGCCCAGAGGCCTTGAGCTGG - Intronic
1161089549 19:2353107-2353129 GGGGGCTGGAGCCCCCATGCGGG + Exonic
1162031054 19:7917407-7917429 GGGGACCAGAGCCACGATCCCGG + Intronic
1162405106 19:10468601-10468623 GGCGCCCAGAACCCCCATCCTGG + Exonic
1162585064 19:11553374-11553396 GGGAGCCAGAGCCCCAAGGCTGG + Exonic
1162751229 19:12830525-12830547 GGGGCCCAAAGCCCCGAGGCAGG + Intronic
1162796951 19:13092005-13092027 GGGGTCCAGGGCCCCTGAGCAGG + Intronic
1162966979 19:14160651-14160673 GGGTTCCAGAGCCCCAAGGCTGG + Exonic
1163608917 19:18291356-18291378 GGGGCCCAGATCCCTTCCGCTGG - Intergenic
1164455118 19:28400386-28400408 GGGCCCCAAAGCCACTCTGCTGG - Intergenic
1165697009 19:37908151-37908173 GTGGCCCAGAGACCCTCTGAGGG + Intronic
1165811847 19:38616585-38616607 GGGGCCCAGGGCACCTGTTCTGG + Intronic
1166230386 19:41422976-41422998 GGGGCCCCTTGCCCCTGTGCAGG + Exonic
1167660702 19:50794484-50794506 GGGGCCCTGGGCCTCTATGATGG + Exonic
925929144 2:8693653-8693675 GGGACGTAGAGCCTCTATGCAGG - Intergenic
926108322 2:10166313-10166335 GGGGCCCACAGCCCTTCTCCCGG + Intronic
926313889 2:11695622-11695644 GGGGCCCAGCTACCCTAAGCTGG - Intronic
929936069 2:46295680-46295702 GGGGCACGGAGCACCTATACAGG - Intronic
930047650 2:47187306-47187328 GAGGCCCAGAGAGGCTATGCGGG - Intergenic
930456172 2:51610161-51610183 GGGGCTAAGAGCCTGTATGCTGG + Intergenic
932274821 2:70443880-70443902 GAGGTCCAGAGCCCCTGTGGTGG - Intergenic
932377806 2:71253628-71253650 GAGGCCCAGAGTTCCCATGCAGG - Intergenic
933560188 2:83877834-83877856 GGGCCCCCAAACCCCTATGCAGG - Intergenic
933780006 2:85794883-85794905 GGGGCCCAGAACCCCAGTTCAGG + Intergenic
937325855 2:120989265-120989287 GGGCCCCTCCGCCCCTATGCTGG + Exonic
938103522 2:128514103-128514125 GGGGCCCAGTCCCACTCTGCAGG - Intergenic
938120927 2:128632504-128632526 AGGGCCAAGAGCCCCCAAGCAGG - Intergenic
938279834 2:130056070-130056092 TGGGCTTGGAGCCCCTATGCAGG + Intergenic
938330786 2:130446785-130446807 TGGGCTTGGAGCCCCTATGCAGG + Intergenic
938359158 2:130674718-130674740 TGGGCTTGGAGCCCCTATGCAGG - Intergenic
938435561 2:131281367-131281389 TGGGCTTGGAGCCCCTATGCAGG - Intronic
941096638 2:161245044-161245066 GGGCCCCAGGGCCCCTTTGCCGG + Intergenic
946010156 2:216558064-216558086 GGCTCCCAGAGGCCCTCTGCTGG + Intronic
946225405 2:218261691-218261713 GGGGCCCTGATCCCCTGTCCTGG + Intronic
948281381 2:236750176-236750198 GAGGCCCTGAGTCCCCATGCTGG + Intergenic
948281390 2:236750206-236750228 GAGGCCCTGAGCCCCTACACTGG + Intergenic
948431575 2:237922432-237922454 AAGGCCCTGAGCCCCTATGAAGG + Intergenic
948813811 2:240499616-240499638 CGGGCCCACAGTCCCTGTGCCGG + Intronic
1171472350 20:25382275-25382297 GGGGCCAAGAGCCAGGATGCCGG - Intronic
1172006750 20:31823318-31823340 GGGCCCCATAGCCCCTATCCTGG + Intronic
1172261414 20:33569146-33569168 GTGGCCCAGTGCCCCTAGGGTGG + Intronic
1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG + Intronic
1172999581 20:39095985-39096007 GGGTCCCAGGGCCCCTGTGGAGG + Intergenic
1174107288 20:48171796-48171818 GGGCCCCAAAGCCCCCCTGCTGG + Intergenic
1174612331 20:51808438-51808460 CTGGCCCAGAGCCCTTCTGCTGG + Intergenic
1175831977 20:61969820-61969842 GGGGCCGAGTGCCCCGATGGGGG - Intronic
1175832001 20:61969881-61969903 GGGGCCGAGTGCCCCGATGAGGG - Intronic
1175935346 20:62511441-62511463 GGGGCCCAGAGGCCATTTACAGG - Intergenic
1176075783 20:63247669-63247691 GGGGCCCCGAGGCCCACTGCTGG + Exonic
1176132755 20:63503172-63503194 AGGGCACAGCGCCCCTGTGCTGG - Intergenic
1179481688 21:41682453-41682475 GGGGCCCAGAGCCCGTGCCCTGG - Intergenic
1179934361 21:44592807-44592829 GGGACACAGAGTCCCTCTGCAGG + Intronic
1181000426 22:19985467-19985489 GGGGCCCAGAGCCCCTATGCTGG - Intronic
1181104527 22:20565954-20565976 GGGGCCCAGAGCCTTTCTGTGGG + Intronic
1183202818 22:36397579-36397601 GGGGCCCTGAGCGCCCATCCAGG - Intergenic
1183374556 22:37455598-37455620 GGCGCCAGGAGCCCCTACGCAGG - Intergenic
1183425114 22:37735041-37735063 CGGGCCCAGACCCCCTCTCCTGG - Exonic
1184240091 22:43207372-43207394 GGGTCCCAGAGCCCTAATGGTGG - Intronic
1184423422 22:44395188-44395210 GCGCCTCAGAGCCACTATGCTGG + Intergenic
1184529145 22:45043394-45043416 GCGGCCCTGAGCCTTTATGCAGG + Intergenic
1185045951 22:48528859-48528881 GGGGCCCAGAGGCCCTGCTCTGG + Intronic
950189354 3:10965986-10966008 GTGGCCCAGAGCCCATGGGCTGG - Intergenic
952878683 3:37969492-37969514 GGGGTCCTGAGCCCGGATGCCGG - Intronic
953605481 3:44410645-44410667 GGGTCCCACAGCACCGATGCAGG - Intergenic
953903509 3:46856874-46856896 GGGGCCCCCAGCCTCTCTGCAGG + Intergenic
954293983 3:49664072-49664094 GGGCCCTAAAGCCCCTGTGCTGG - Intronic
954414132 3:50384747-50384769 GGGGCCCTGAGCTCCTAGGAGGG - Intronic
954681072 3:52346269-52346291 GGGGCCCAGAGCTGCTGGGCAGG - Intronic
957268923 3:78003527-78003549 GGGGCCCAGCGTCCCAATCCTGG - Intergenic
961430739 3:126881133-126881155 GGGGCAAACAGCCCATATGCGGG - Intronic
962847986 3:139287797-139287819 TGGTCCCAGAGCCCATGTGCTGG + Intronic
968688478 4:1977106-1977128 GGGGCCCAGAGCCCCTGTCCTGG + Intronic
969299518 4:6289534-6289556 TGGGCCCACAGCCCCTCAGCTGG - Intronic
969321423 4:6415235-6415257 GGGGCTCTGAGCCCCCAGGCCGG - Intronic
980182211 4:129414775-129414797 GTTGCTCAGGGCCCCTATGCTGG - Intergenic
985748538 5:1661453-1661475 AGGGCCCAGAGCCCCTCTCAAGG - Intergenic
988828744 5:34967560-34967582 GGGGACCAGACTGCCTATGCAGG + Intergenic
997385390 5:133468207-133468229 GGTGCCCAGAGGTCCTGTGCTGG - Intronic
1001224118 5:169929113-169929135 GGGAACCAGAGTGCCTATGCAGG + Intronic
1002367250 5:178723208-178723230 GGTCCCCACAGCCCCTGTGCTGG - Intronic
1002386240 5:178869275-178869297 GGTCCCCATAGCCCCTGTGCTGG + Intronic
1002436982 5:179237700-179237722 GAGGCCCAGAGCCCCTCATCAGG - Intronic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1007386738 6:41525084-41525106 GGTCCCCAGTGCCTCTATGCTGG - Intergenic
1008363573 6:50649959-50649981 TGGGCCCAGGGGCCCTCTGCTGG + Intergenic
1008559980 6:52714194-52714216 GGAGCCCATCACCCCTATGCAGG - Intergenic
1018725017 6:166605153-166605175 GGGGGCCAGGGCCCCTGTGCAGG - Intronic
1019708974 7:2509777-2509799 GGGGCTCAGAGCCCCGAGGAGGG + Intergenic
1019747526 7:2709124-2709146 GGGGCCCAGCGCCCCTGATCTGG + Exonic
1024657650 7:51465313-51465335 GAGGCCCAGAGCCCCTTGGAAGG - Intergenic
1027188877 7:75986684-75986706 GGAGCCCGGTGCCCCCATGCAGG - Exonic
1030994012 7:116335860-116335882 GGTCCCCAGAGGCCCTATACTGG - Intronic
1031976533 7:128097222-128097244 CGGGCCCAGAGCCCTCAAGCAGG + Intergenic
1032179245 7:129661175-129661197 TGGGCCCAGGGTCCCTGTGCTGG - Intronic
1034684027 7:152954068-152954090 GGGCCCTTGAGCCCCTATGCTGG - Intergenic
1035388667 7:158490628-158490650 GGGCCCCAGGGCCACTAGGCGGG + Intronic
1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG + Intergenic
1040504055 8:48030987-48031009 GTGGCCCAGAGCCACAATGAAGG - Intronic
1040850657 8:51898539-51898561 GGGGACCAGAGTCCCGAGGCTGG - Intronic
1042485043 8:69338928-69338950 TGGGCCCAGAGCAGCAATGCTGG + Intergenic
1043381022 8:79702223-79702245 GGGGGCTACAGCCCCTGTGCAGG - Intergenic
1048339763 8:133529543-133529565 GGGGCCCGGAGCCCCTCCTCTGG - Intronic
1049206021 8:141363941-141363963 GGTGCTCAGAGCCCCTCTGTGGG - Intronic
1049333210 8:142066396-142066418 GGGGACTCCAGCCCCTATGCTGG + Intergenic
1049575612 8:143388478-143388500 GGGGACCTGGGCCCCTATGGGGG + Intergenic
1049640493 8:143712970-143712992 AGGGTCCAGAGCCCCTACACAGG + Intronic
1052878052 9:33582006-33582028 TGGGCTTGGAGCCCCTATGCAGG - Intergenic
1053497929 9:38562198-38562220 TGGGCTTGGAGCCCCTATGCAGG + Intronic
1057016584 9:91657677-91657699 GGGGCCCCCATCCCCTCTGCTGG + Intronic
1057908998 9:99003906-99003928 GGGGCCCAGAGCCCAGACTCGGG + Intronic
1060869726 9:127029894-127029916 GTGGCCCAGAGCAGCTTTGCAGG + Intronic
1061306144 9:129734458-129734480 GGGGCCCAGAGCCTCGATTCAGG - Intergenic
1061394166 9:130334202-130334224 GTGGTCCAGTGCCCCCATGCAGG + Intronic
1061397832 9:130353115-130353137 AGGGCCCAGAGCTCCGATGCCGG + Intronic
1061610321 9:131741154-131741176 GAGGCCTAGAGCCTCCATGCTGG + Intergenic
1062413473 9:136436313-136436335 GAGGCCCACGGCCCCTTTGCCGG + Intronic
1062429742 9:136521633-136521655 GGGGCGCAGAGCCCTTCTGCTGG - Intronic
1185446110 X:258706-258728 AGGTCCCAGAGACCCTCTGCTGG - Intergenic
1186517896 X:10180449-10180471 GGGGCCCAGAGCCTCTGGGTAGG + Intronic
1186876922 X:13826245-13826267 GGGGCACAGAGACCCTAGGGAGG + Intronic
1190537855 X:51447151-51447173 TGGGCCCAGAGCCAGTATTCTGG - Intergenic
1192356713 X:70410834-70410856 GGGGTCCACAACCCCTAGGCTGG - Intronic
1196420222 X:115513616-115513638 GTGCCCTTGAGCCCCTATGCTGG + Intergenic
1200137706 X:153883078-153883100 TGGGCCCAGACCCCCCATGGGGG - Intronic