ID: 1181003125

View in Genome Browser
Species Human (GRCh38)
Location 22:19997302-19997324
Sequence AGCAACTGTCCCTCCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181003125 Original CRISPR AGCAACTGTCCCTCCTCTGT GGG Intronic
900649384 1:3723543-3723565 AGCCCCTGTCCCTCCTCAGTTGG + Intronic
901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG + Exonic
901952553 1:12760447-12760469 AGTAATTGTCCCACCCCTGTCGG - Intronic
904670753 1:32163213-32163235 ATCAGATCTCCCTCCTCTGTAGG + Exonic
906331053 1:44884685-44884707 AGCAAATGTTCCTCCTCCATTGG + Intronic
907856487 1:58308505-58308527 AGCACCTGTCCCTCCCCTACAGG + Intronic
910763948 1:90762026-90762048 AGCCACCGTCCCTCCTCCCTCGG - Intergenic
912445921 1:109736598-109736620 AGCAATTGTCCCAACTCTATTGG + Exonic
913649971 1:120904142-120904164 AGTAATTGTCCTTCCTTTGTAGG - Intergenic
915167002 1:153953562-153953584 AACAACTGCCCCTTCTCTGCAGG + Exonic
918996929 1:191773660-191773682 AGAAACTGTCCCACCTGTGCAGG + Intergenic
919222337 1:194644992-194645014 AGCACCAGCCCCTCTTCTGTTGG + Intergenic
919834676 1:201565607-201565629 AGGAACTGAGCCCCCTCTGTGGG + Intergenic
920122049 1:203666102-203666124 AGCAACTGTGGCACCACTGTAGG - Intronic
921265375 1:213417087-213417109 GGCTACTGTCCCTCCTCAGAGGG + Intergenic
921512141 1:216045047-216045069 AGATACTGTCCCTCTTCTCTTGG - Intronic
921637433 1:217512897-217512919 AGCAATTCTCTCTCCTCTCTTGG - Intronic
1067287935 10:44921120-44921142 AGTCTCTGTCCCTCCTGTGTGGG - Intronic
1067563739 10:47322071-47322093 AGCAAGCCTCCCTGCTCTGTTGG - Intergenic
1069959982 10:72073846-72073868 AGCAACTGTCTCTGCCCCGTAGG - Intronic
1070350165 10:75583993-75584015 AGGGACTGTCCTTCCTCTCTGGG + Intronic
1071351484 10:84750443-84750465 AGCCACTGTCCCTTCTGTGCAGG + Intergenic
1072556461 10:96518311-96518333 ACCGACTGTCCATGCTCTGTGGG + Exonic
1072626707 10:97116768-97116790 AGCATCTGGGCTTCCTCTGTAGG + Intronic
1073747547 10:106486625-106486647 AGAAATTGTCCTTCCTCTTTTGG - Intergenic
1075023563 10:118967992-118968014 AGCCACAGTCCCACCTCAGTGGG - Intergenic
1076677248 10:132153515-132153537 AGCTAGTGTCCCTCCTCTCCTGG + Intronic
1078020312 11:7651539-7651561 AGCTCCTGTCCCTCCTCTGGAGG + Intronic
1078495622 11:11813610-11813632 AGCAAATGTCCAGCCTCTGAAGG + Intergenic
1079082758 11:17425281-17425303 GGCAAATTTCCCTCCTCAGTGGG - Intronic
1082216007 11:49570415-49570437 AGAATGTGTTCCTCCTCTGTTGG + Intergenic
1083332258 11:61904428-61904450 AGCAACTGTCCCTGTCCTGTCGG + Intronic
1088919442 11:114250732-114250754 AGCCACTGCCCCTCCTCTGGGGG + Intergenic
1090834047 11:130440922-130440944 AGAAACTTTTCCTCCTCTTTGGG + Intergenic
1091177303 11:133572939-133572961 AGACACTGTCCCTACTCTGAAGG - Intergenic
1093494376 12:19738841-19738863 ACTAACTGACTCTCCTCTGTGGG - Intergenic
1095628623 12:44347639-44347661 TGCAGCTGTCCCTTCTCTCTTGG + Intronic
1096093232 12:48916935-48916957 AGACACTGTCCCTGCTCTGAGGG - Intronic
1096124778 12:49111038-49111060 AGCAACTGTCTCTCTTATCTGGG + Intergenic
1099986292 12:89668728-89668750 AGTATCAGTACCTCCTCTGTTGG - Intronic
1100586064 12:95980831-95980853 AGAAACTGTCTCTCCCCTATTGG + Exonic
1101999615 12:109548788-109548810 GGCATCTCTTCCTCCTCTGTTGG - Intergenic
1102502118 12:113359761-113359783 AGCAGCTGTCTCTACTCAGTGGG + Intronic
1102783531 12:115585477-115585499 AACAACTGTCCCTCGTGTCTAGG + Intergenic
1104936678 12:132368136-132368158 AGCACCCGTCTCTCCTCTCTTGG + Intergenic
1105019568 12:132807109-132807131 AGCATGTGTGGCTCCTCTGTTGG - Intronic
1107886596 13:44878887-44878909 AGTAACTGGCCCTCCTGAGTTGG - Intergenic
1109108855 13:58290551-58290573 AGCAACTATCCTTGCTCTCTGGG - Intergenic
1114190962 14:20439095-20439117 AGCAAGGGTCCTGCCTCTGTGGG + Intergenic
1118994201 14:70822138-70822160 GGAAACTGTCCCTCCTGTGCCGG - Intergenic
1121591335 14:95113881-95113903 AGCCAGTCTCCCTGCTCTGTAGG - Intronic
1121778632 14:96607457-96607479 ACCAACTGTGCCTCATCTTTCGG - Intergenic
1122387909 14:101361545-101361567 AGCATGTTTTCCTCCTCTGTAGG + Intergenic
1123019835 14:105392485-105392507 AGCACCCGGCCCTCCTCTGCTGG + Intronic
1124582763 15:30975616-30975638 AGCTACTGTCCCTACACAGTGGG + Intronic
1127246622 15:57183433-57183455 AGCATCTGTCAATCCTCTCTAGG + Intronic
1127659016 15:61082553-61082575 ACAAAATGTCACTCCTCTGTAGG - Intronic
1129332399 15:74834376-74834398 AACAACTCTGCCTCCTCTGAAGG + Intergenic
1129869501 15:78931642-78931664 AGCAACTGTCCCTGCCCTTGGGG - Intronic
1130613160 15:85379909-85379931 AGAAACCGCCCTTCCTCTGTGGG + Intergenic
1132106058 15:99063626-99063648 AGCTGCTGCCCCTCCACTGTAGG + Intergenic
1137714634 16:50591276-50591298 AGCCACTGTGGCTCCCCTGTGGG + Intronic
1139969091 16:70762746-70762768 AGCACCTGTCACTTCTCTGCCGG + Intronic
1140523296 16:75600910-75600932 AGCAACTCTGTCTCCTTTGTAGG + Intronic
1144462546 17:15469555-15469577 TGCATTTCTCCCTCCTCTGTGGG + Intronic
1151016948 17:70566021-70566043 AGAATCTGTCCCTTGTCTGTAGG + Intergenic
1151606402 17:75139856-75139878 AACAAACCTCCCTCCTCTGTGGG - Intronic
1152297347 17:79475805-79475827 GGCCACTGGCCATCCTCTGTGGG - Intronic
1152572418 17:81126653-81126675 AGCTGCTGTCCCTCAGCTGTGGG - Intronic
1152596758 17:81241631-81241653 AGCCAGTGCCCCTCCTGTGTGGG + Intergenic
1158701526 18:59752777-59752799 AGCAACTGACACTTCTTTGTTGG + Intergenic
1160305534 18:77731766-77731788 AGCTCTTGTCCCTGCTCTGTTGG - Intergenic
1160327717 18:77966411-77966433 AGGAACTGACTCTCCTCTGAGGG + Intergenic
1161221628 19:3120578-3120600 GGCCACTGTTCCTGCTCTGTAGG + Intronic
1161414783 19:4139851-4139873 AGAGCCTGTCCCTCCTCTGCCGG - Intergenic
1161569696 19:5023707-5023729 AGTATCAGGCCCTCCTCTGTGGG - Intronic
1161736630 19:5995672-5995694 AGCAACTGCCGCCCCTCTGCAGG - Intronic
1165266958 19:34668424-34668446 AGCCTCTCCCCCTCCTCTGTGGG + Intronic
931040480 2:58292746-58292768 ACACACTATCCCTCCTCTGTAGG + Intergenic
938098290 2:128477395-128477417 TGCAGCTTTCACTCCTCTGTGGG + Intergenic
938568276 2:132540004-132540026 AGCAACTTCCTTTCCTCTGTGGG - Intronic
940646614 2:156398850-156398872 ATCAACTTTACGTCCTCTGTTGG + Intergenic
942454018 2:176125352-176125374 AGCAACTGTCCCAGCTCGGTGGG + Intergenic
948234885 2:236379910-236379932 AACACCTGTCGCTCCACTGTTGG - Intronic
1168833221 20:858901-858923 AGAAACTGTCCCAGCTCTGGAGG + Intergenic
1168949207 20:1784976-1784998 AGCAACTCTCTGTCCTCTCTGGG - Intergenic
1170445539 20:16423785-16423807 ATCAACTGTCTGTTCTCTGTGGG - Intronic
1172928781 20:38566365-38566387 AGAACCTGTCCGTCCTCTTTGGG + Intronic
1175700735 20:61135189-61135211 CGCAACTCTCCCTCTTCTGGGGG + Intergenic
1175942428 20:62543646-62543668 AGTAGCTGCCCCTCCTCAGTGGG + Intergenic
1176124479 20:63469395-63469417 ATCCACTGTTGCTCCTCTGTGGG - Intronic
1178192445 21:30300048-30300070 AAGAAATGTCTCTCCTCTGTGGG - Intergenic
1180173167 21:46071375-46071397 GGCTCCTGCCCCTCCTCTGTGGG - Intergenic
1181003125 22:19997302-19997324 AGCAACTGTCCCTCCTCTGTGGG + Intronic
1182575905 22:31272732-31272754 AGCATCTGTCCTCCCTCTGCGGG - Intronic
1183136184 22:35890281-35890303 AGGTAGTGTCCCTCATCTGTGGG + Intronic
1184235620 22:43181583-43181605 ATCAACTGTCCCTACCCTGTAGG + Intronic
1184867477 22:47209626-47209648 AGGAGCTGGCCCTCCCCTGTGGG - Intergenic
950764024 3:15260083-15260105 AGCTCATGTTCCTCCTCTGTGGG + Intronic
953584570 3:44188044-44188066 AGCAAATGTTCCCCTTCTGTGGG - Intergenic
953715355 3:45312749-45312771 AGCAAAAGTGCCTCCTCTCTGGG - Intergenic
953957751 3:47244740-47244762 AGCAGCTGGCCCTCCTCGGTGGG - Intronic
954183614 3:48900279-48900301 TGCCACTGTCTCTCCTCTGAAGG + Intergenic
959595280 3:108122595-108122617 AGGAGCTGTCTCTCCTCTCTCGG - Intergenic
965553600 3:169996818-169996840 AGCTACTGTGCTTCCTCTTTGGG + Exonic
966769310 3:183490309-183490331 AGAATCTGTCGCTCCTGTGTAGG + Exonic
967876770 3:194272868-194272890 AGGATCAGTCCGTCCTCTGTTGG - Intergenic
967972163 3:195007062-195007084 AGCCACTGTGCCTGATCTGTAGG - Intergenic
968905429 4:3448526-3448548 AGGAACTGTCCGGGCTCTGTGGG - Intronic
969346146 4:6571327-6571349 AGCAACCCTACCTCCTCTGATGG - Intergenic
969695287 4:8730818-8730840 AGCAACTGGCCACCCACTGTGGG - Intergenic
972437851 4:39051580-39051602 ATCAAATGTTCCTCCTCAGTGGG + Intronic
974096625 4:57371278-57371300 AGCAATTGTCCCCCGTCTGCTGG - Intergenic
974180525 4:58379249-58379271 AGCAACTGCACCTCCACTGAAGG - Intergenic
975185913 4:71402506-71402528 AGACACTGTACCTCCTCTGAGGG - Intronic
977438681 4:97035293-97035315 AGGAACTGTCCCTGCCCTGAAGG - Intergenic
982560115 4:156919408-156919430 AGTAACTCTCCCTCTTCAGTTGG - Intronic
984883887 4:184432972-184432994 TGCAGCTCTCCCTTCTCTGTTGG - Intronic
985591774 5:769413-769435 ATCAACGGTCCATCCTCTTTAGG + Intergenic
985609689 5:880372-880394 ATCAACGGTCCATCCTCTTTAGG + Intronic
986051000 5:4090288-4090310 AGCAGCTGCCCCTCCTCCCTGGG + Intergenic
987186513 5:15425957-15425979 ACCAACTGTCTTTCCTTTGTGGG - Intergenic
990253069 5:53936950-53936972 AGAAACTGTTCCTCCTTTGCAGG + Intronic
990949850 5:61287795-61287817 AGCCACTGTCCCTCATTTATTGG + Intergenic
993027137 5:82660234-82660256 AGCAATGGTCCCTCACCTGTGGG - Intergenic
993870354 5:93245810-93245832 AACAACTGTGACTGCTCTGTAGG - Intergenic
995523843 5:113035135-113035157 AGCCACTCTCTCTCCTGTGTTGG + Intronic
999684827 5:154092996-154093018 AGCAACTGTCCAGCAACTGTAGG + Intronic
1001112017 5:168904435-168904457 AGCCTCTGACTCTCCTCTGTGGG + Intronic
1001838211 5:174850499-174850521 AGCAACTGTTTGTCCTCTCTGGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006919786 6:37619819-37619841 AACAAAAGTCCCTGCTCTGTTGG + Intergenic
1008520236 6:52356113-52356135 AGGCACAGACCCTCCTCTGTTGG - Intergenic
1013233649 6:108177464-108177486 TGCAGCTGGCCCTCCTCTGAGGG - Intronic
1014180447 6:118378345-118378367 AGCAGCTGGCCCACTTCTGTAGG - Intergenic
1014707912 6:124770759-124770781 AGTACCTGTCACTCCTCTGGAGG - Intronic
1014759227 6:125337441-125337463 AGCAAATCTCTCTCCTCTGTTGG + Intergenic
1016320929 6:142845228-142845250 AGCAAGACTTCCTCCTCTGTGGG + Intronic
1018370652 6:163165191-163165213 AGAAACTGTCACTCCTCTGGAGG - Intronic
1018765815 6:166932104-166932126 AGCAAATGTCACTCCTATGGAGG + Intronic
1019827260 7:3294679-3294701 AGTAACTGTCCCTCAGCTCTCGG - Intergenic
1021266494 7:18530350-18530372 AGCAAGTGTCCCTCAACTCTGGG - Intronic
1023199018 7:37673380-37673402 AGCAGCAGGCCCTGCTCTGTGGG - Intergenic
1023220788 7:37918757-37918779 GTCAACTGTCCCTCCTCTTCGGG + Intronic
1023845072 7:44115982-44116004 AGCATCTGTTCCTTCTCTCTGGG - Intronic
1023920462 7:44625588-44625610 AGCTCCTGTGCCTCATCTGTAGG + Intronic
1024245957 7:47470829-47470851 AGCTATTGTCCCACCTCTGCAGG - Intronic
1026690520 7:72546640-72546662 AGCACCTCTCCCACCTCTGTGGG - Intergenic
1027797019 7:82708566-82708588 AGCAGCAGTGCCTCTTCTGTTGG + Intergenic
1028144900 7:87310831-87310853 AGCTAATATCCCTTCTCTGTTGG + Intergenic
1028206754 7:88026321-88026343 GGCACCTCTCCCTTCTCTGTTGG - Intronic
1028416593 7:90587200-90587222 ATCAACTGTCCCTCTTTTCTTGG + Intronic
1030889952 7:114987106-114987128 AGTAACTGTCCTCCCTCTGCTGG - Intronic
1032811381 7:135421777-135421799 AACAACTGCACCTCCACTGTTGG + Intronic
1032997087 7:137459278-137459300 TGCAACTGACCCGGCTCTGTTGG - Intronic
1033169328 7:139069744-139069766 AGCATATGTGCCTACTCTGTTGG + Intronic
1034882630 7:154774127-154774149 AGCCACAGGCCCTCCTATGTTGG - Intronic
1039943674 8:42112118-42112140 AGCAACTGTCTCTACTCTACTGG + Intergenic
1040577698 8:48668161-48668183 AGGAACAGTCCCTTCTCTCTAGG + Intergenic
1042173013 8:66010537-66010559 AGCCACTGTTCCTCCAATGTGGG + Intergenic
1042175278 8:66032386-66032408 AGCAACTATTCATGCTCTGTGGG - Intronic
1044667114 8:94641947-94641969 TGCAACTGTCCCACCTCCGAAGG - Exonic
1046367232 8:113250809-113250831 AGCAACAGTCACTCTTCTATTGG - Intronic
1048604778 8:135956314-135956336 AGCAACTCACCATCCTCTTTAGG - Intergenic
1049708006 8:144051651-144051673 TGCAACTGTTCCCCCTCTGTGGG + Intronic
1050117175 9:2275078-2275100 AGCTACTGACCCTCCCTTGTGGG - Intergenic
1051278936 9:15422567-15422589 AGCAACTGTCTCTGCCCGGTAGG - Intergenic
1052014896 9:23452351-23452373 AGCATCTGTCCCTGCTCCATGGG + Intergenic
1053007503 9:34613774-34613796 AGCAGCTATCACTCCTCTGCTGG + Exonic
1053666875 9:40323202-40323224 AGAGACTGTCCCTGCTGTGTGGG + Intronic
1053916467 9:42948309-42948331 AGAGACTGTCCCTGCTGTGTGGG + Intergenic
1054378027 9:64463230-64463252 AGAGACTGTCCCTGCTGTGTGGG + Intergenic
1054517734 9:66053081-66053103 AGAGACTGTCCCTGCTGTGTGGG - Intergenic
1060274909 9:122175108-122175130 AGCATCCGTCCCACCTCTCTGGG - Intronic
1062665062 9:137666118-137666140 AGCAAGCGTCCCTGCTCTGCAGG - Intronic
1196641598 X:118068853-118068875 AACAACTGTCCCTTCCCTGTGGG + Intronic
1196755836 X:119156312-119156334 AGCAAGTGTCCCTCCTCCAATGG - Intergenic
1198408862 X:136345543-136345565 AGCAAGTGTCCATCAGCTGTAGG - Exonic
1198479451 X:137027986-137028008 AGGCACTGCCCCTCCCCTGTAGG + Intergenic
1200411898 Y:2869204-2869226 TGCCACTGTCACTCCTCTGTTGG + Intronic