ID: 1181004191

View in Genome Browser
Species Human (GRCh38)
Location 22:20002184-20002206
Sequence GTCACGGATGTGTCTACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181004187_1181004191 -3 Left 1181004187 22:20002164-20002186 CCAGAAAAGAAGCCCAGGAAGTC 0: 1
1: 0
2: 1
3: 21
4: 223
Right 1181004191 22:20002184-20002206 GTCACGGATGTGTCTACCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 85
1181004185_1181004191 5 Left 1181004185 22:20002156-20002178 CCTTCTGTCCAGAAAAGAAGCCC 0: 1
1: 0
2: 2
3: 15
4: 210
Right 1181004191 22:20002184-20002206 GTCACGGATGTGTCTACCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181004191 Original CRISPR GTCACGGATGTGTCTACCTC TGG Intronic
901335725 1:8447423-8447445 TTCGTGGATGTGTCTACCTTTGG + Intronic
904211123 1:28887463-28887485 GACCCGGACGTGTCTAGCTCCGG - Intronic
906825634 1:48976691-48976713 GTCAAGCATGCATCTACCTCTGG + Intronic
909131723 1:71745503-71745525 GTTACAGATGTGTCTCACTCAGG - Intronic
913286322 1:117229965-117229987 GACACTGATGGCTCTACCTCAGG - Intergenic
919780630 1:201218583-201218605 GTCACAGCTGTGGCTCCCTCAGG + Exonic
924864579 1:247963796-247963818 GTCATATATGTGTCTACCTATGG - Intronic
1064259415 10:13773137-13773159 GTCACCAATATGTCTACCTATGG + Intronic
1067231024 10:44410836-44410858 TTCACGGATTTATCTACCTTTGG + Intergenic
1069629921 10:69891408-69891430 GTCAAGGATTTTCCTACCTCAGG - Intronic
1069708673 10:70475363-70475385 GTCACGGATGAGTTTGCCTGAGG + Intergenic
1073609405 10:104928470-104928492 GTTACAGATATCTCTACCTCAGG - Intronic
1074899969 10:117807603-117807625 CACACAGATGTGGCTACCTCTGG + Intergenic
1082909057 11:58349262-58349284 GTCATGGCTGTGTCTTGCTCTGG - Intergenic
1082984783 11:59159122-59159144 GCCAAGGCTCTGTCTACCTCTGG + Intergenic
1086907022 11:92430460-92430482 TTCATGGATTTGTCTACCTTTGG + Intronic
1091089902 11:132761937-132761959 TTCATGGATTTATCTACCTCTGG + Intronic
1091752737 12:3032822-3032844 GTCACATATGTGTCTTCCTCTGG - Intronic
1095247753 12:39942883-39942905 TTCATGGATTTATCTACCTCTGG + Intronic
1095926382 12:47583730-47583752 GTCAGGCATGTTCCTACCTCAGG - Intergenic
1098780280 12:74677397-74677419 TTCATGGATTTGTCTACCTTTGG - Intergenic
1115486479 14:33915706-33915728 GTCAAGGTTGTTTCTGCCTCAGG - Intergenic
1119539715 14:75429892-75429914 GTCATGGGTGTGTAGACCTCTGG + Intronic
1119539724 14:75429941-75429963 GTCATGGGTGTGTAGACCTCTGG + Intronic
1125675397 15:41499649-41499671 GTCAGGGAGGTGTATTCCTCTGG + Intronic
1130728562 15:86466621-86466643 GTCATGGATTTATCTACCTTTGG + Intronic
1133047301 16:3095854-3095876 GTCATGGTTGTGTATACCTGTGG + Intronic
1147426248 17:40347211-40347233 GGCAGGGATCTGTCTACCTAGGG + Intronic
1147548412 17:41420903-41420925 GTCACCGGTGGGTCTCCCTCTGG - Exonic
1148967508 17:51447999-51448021 TTCATGGATTTGTCTACCTTTGG - Intergenic
1149313426 17:55418023-55418045 ATCAAGGTTGTGTCTGCCTCTGG + Intronic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1166182507 19:41118919-41118941 GTCTCAGATGTGTTTATCTCTGG - Intronic
1167137705 19:47627239-47627261 GTCACCCATGTCTCTAGCTCAGG - Intronic
1167825371 19:51968131-51968153 GTGATGGATGTGGCTTCCTCAGG - Intronic
1167863052 19:52300463-52300485 GTCAGGGATGGCTCTTCCTCAGG + Exonic
1167868645 19:52349214-52349236 GTCAGGGATGGCTCTTCCTCAGG + Exonic
1167910634 19:52699150-52699172 GTCAGGGATGGCTCTTCCTCAGG - Intergenic
1167918290 19:52760376-52760398 GTCAGGGATGGCTCTTCCTCAGG - Intergenic
1167925468 19:52817943-52817965 GTCAGGGATGGCTCTTCCTCAGG - Exonic
1167929712 19:52854257-52854279 GTCAGGGATGGCTCTTCCTCAGG - Exonic
1167937059 19:52917858-52917880 GTCAGGGATGGCTCTTCCTCAGG - Intergenic
1167969920 19:53182883-53182905 GTCAGGGATGGCTCTTCCTCAGG - Exonic
1167992516 19:53372275-53372297 GTCAGGGATGGCTCTTCCTCAGG + Exonic
1167995431 19:53398009-53398031 GTCAGGGATGGCTCTTCCTCAGG + Exonic
1168005565 19:53483816-53483838 GTCAGGGATGGCTCTTCCTCAGG + Exonic
1168148855 19:54434383-54434405 GTCCTGGATCTGTCTGCCTCTGG + Intronic
925350853 2:3199979-3200001 GTGACGGGTGTGTCTGCATCTGG + Intronic
927117294 2:19917255-19917277 TTCATGGATTTGTCTACCTTTGG - Intronic
930772834 2:55144875-55144897 GTCACGGGGGTGTATTCCTCAGG - Intergenic
933774047 2:85761151-85761173 GTCCCTTATGTGGCTACCTCCGG + Intronic
938069398 2:128300464-128300486 TTCGCGGAGGTGTCTACCTGGGG + Intronic
942407331 2:175669329-175669351 TTCATGGATTTGTCTACCTTTGG - Intergenic
948318605 2:237050754-237050776 TTCACAGAGGTGTCTTCCTCGGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1180003327 21:45005020-45005042 GTCACGGGCGTGACTCCCTCAGG + Intergenic
1181004191 22:20002184-20002206 GTCACGGATGTGTCTACCTCTGG + Intronic
1181322704 22:22020676-22020698 GTCACTGAAGTGTCCTCCTCTGG + Intergenic
1183730700 22:39617011-39617033 GTCATGGATGTGGCTTGCTCTGG + Intronic
952701620 3:36335050-36335072 GTCACGGGTGTGACTACCTGGGG + Intergenic
957747568 3:84365396-84365418 TTCATGGATTTGTCTACCTTTGG + Intergenic
961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG + Intronic
962143561 3:132816810-132816832 GTCACCCTTGTCTCTACCTCAGG - Intergenic
974251656 4:59393641-59393663 TTCACGGATTTTTCTACCTTTGG + Intergenic
983958690 4:173727072-173727094 TTCATGGATTTGTCTACCTTTGG + Intergenic
984678857 4:182583174-182583196 TTCTGGGATGTGTCTCCCTCGGG - Intronic
987271791 5:16317045-16317067 GTCAAGGATTTGACTACTTCTGG + Intergenic
988766907 5:34388321-34388343 GTCATGGATTTGTCTACTTTTGG + Intergenic
992256862 5:74929873-74929895 GTCAGGGATGGCTCTTCCTCAGG + Intergenic
996270904 5:121603164-121603186 TTCATGGATTTGTCTACCTTTGG - Intergenic
1007784690 6:44272872-44272894 GTCACTTCTGTTTCTACCTCTGG + Intronic
1009880617 6:69561475-69561497 TTCATGGATGTATCTACCTTTGG - Intergenic
1013418735 6:109947388-109947410 GTCACCGAAGTACCTACCTCAGG + Intergenic
1016767910 6:147815542-147815564 GTCCCTGCTGTGTCTGCCTCAGG - Intergenic
1020345407 7:7156988-7157010 TTCACGGAAGTGTTTTCCTCAGG + Intronic
1023247872 7:38225851-38225873 GACACGGATGTGTCTGCATGTGG + Intronic
1031173217 7:118317445-118317467 TTCATGGATTTGTCTACCTTTGG + Intergenic
1040616469 8:49042763-49042785 GTCAGGGAGGTGCCTACCTGGGG + Intergenic
1044509346 8:93057628-93057650 CTCATGGATTTGTCTACCTTTGG + Intergenic
1046047856 8:108985687-108985709 TTCACGGATTTATCTACCTTTGG + Intergenic
1050972250 9:11892905-11892927 GTCATGGATATGTGCACCTCAGG + Intergenic
1052667889 9:31518515-31518537 TTCACGGATTTATCTACCTTTGG + Intergenic
1055302623 9:74898150-74898172 GTCACTGCTGTGTCAAGCTCAGG + Intergenic
1062414555 9:136441644-136441666 GTCACTGCTGTGTCTCCCTGGGG + Exonic
1191244449 X:58214873-58214895 GTCACCCATGTGTCTACCATTGG - Intergenic
1192252873 X:69427902-69427924 GTCAAGCATGTTTCTACCACAGG - Intergenic
1192712513 X:73606612-73606634 TTCATGGATTTGTCTACCTTTGG + Intronic
1199690927 X:150308601-150308623 CTCAAGGTTGTGTCTTCCTCAGG - Intergenic