ID: 1181005608

View in Genome Browser
Species Human (GRCh38)
Location 22:20012087-20012109
Sequence CACACTTCCCCAACTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181005608_1181005615 -5 Left 1181005608 22:20012087-20012109 CCCCACCCAGTTGGGGAAGTGTG 0: 1
1: 0
2: 1
3: 5
4: 149
Right 1181005615 22:20012105-20012127 GTGTGACCAAAGGAGAACATGGG 0: 1
1: 0
2: 2
3: 18
4: 205
1181005608_1181005621 24 Left 1181005608 22:20012087-20012109 CCCCACCCAGTTGGGGAAGTGTG 0: 1
1: 0
2: 1
3: 5
4: 149
Right 1181005621 22:20012134-20012156 CTCATGGGCCTCCTACCTCATGG No data
1181005608_1181005622 25 Left 1181005608 22:20012087-20012109 CCCCACCCAGTTGGGGAAGTGTG 0: 1
1: 0
2: 1
3: 5
4: 149
Right 1181005622 22:20012135-20012157 TCATGGGCCTCCTACCTCATGGG 0: 1
1: 0
2: 0
3: 10
4: 101
1181005608_1181005614 -6 Left 1181005608 22:20012087-20012109 CCCCACCCAGTTGGGGAAGTGTG 0: 1
1: 0
2: 1
3: 5
4: 149
Right 1181005614 22:20012104-20012126 AGTGTGACCAAAGGAGAACATGG 0: 1
1: 0
2: 4
3: 23
4: 394
1181005608_1181005618 9 Left 1181005608 22:20012087-20012109 CCCCACCCAGTTGGGGAAGTGTG 0: 1
1: 0
2: 1
3: 5
4: 149
Right 1181005618 22:20012119-20012141 GAACATGGGTCCTTCCTCATGGG 0: 1
1: 0
2: 1
3: 15
4: 150
1181005608_1181005617 8 Left 1181005608 22:20012087-20012109 CCCCACCCAGTTGGGGAAGTGTG 0: 1
1: 0
2: 1
3: 5
4: 149
Right 1181005617 22:20012118-20012140 AGAACATGGGTCCTTCCTCATGG 0: 1
1: 0
2: 2
3: 18
4: 190
1181005608_1181005623 26 Left 1181005608 22:20012087-20012109 CCCCACCCAGTTGGGGAAGTGTG 0: 1
1: 0
2: 1
3: 5
4: 149
Right 1181005623 22:20012136-20012158 CATGGGCCTCCTACCTCATGGGG 0: 1
1: 0
2: 1
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181005608 Original CRISPR CACACTTCCCCAACTGGGTG GGG (reversed) Intronic
900188993 1:1345430-1345452 CACCCTCCCCCATCTGGCTGGGG - Intronic
901100609 1:6715853-6715875 CTCACTTCCCAGACGGGGTGGGG + Intergenic
902091413 1:13906736-13906758 CACTCTGTGCCAACTGGGTGTGG + Intergenic
902292185 1:15442594-15442616 CACACTGCCCCCAGTGGCTGTGG - Intronic
904095040 1:27970288-27970310 CACAGTTGCCCAGCTGTGTGGGG - Intergenic
905451772 1:38061738-38061760 CAGACTTCCCCAACTCAATGTGG - Intergenic
906236320 1:44213518-44213540 CGCACTTCCGCACCTGGGTCCGG - Exonic
907441395 1:54480691-54480713 CTCCCTTCCCCAGCTGGGGGTGG + Intergenic
909862090 1:80620231-80620253 CACTCTGCTCCAAGTGGGTGTGG - Intergenic
910071373 1:83218262-83218284 CAAACTTCCCCAGCTGGATTAGG - Intergenic
910849497 1:91636486-91636508 CCCACTTCCCGAATTGGATGTGG - Intergenic
910929604 1:92429706-92429728 CACAGTGCACCAGCTGGGTGCGG - Intergenic
913257874 1:116971728-116971750 CTCACTTCCCCTACTGGACGTGG - Intronic
913437492 1:118862427-118862449 AAGAATTCCCCATCTGGGTGCGG + Intergenic
914894580 1:151657738-151657760 CACACTCCTCCTGCTGGGTGCGG + Intronic
914916845 1:151824270-151824292 CCTACTTCCCCGCCTGGGTGGGG + Intronic
915924665 1:160007004-160007026 CACATTTCCCCAAGTGGGGAGGG + Intergenic
916873107 1:168938761-168938783 CACACTTCCCAAGCTTGGGGTGG - Intergenic
918895623 1:190340288-190340310 GACATTTGCCAAACTGGGTGAGG + Intronic
919671051 1:200338348-200338370 CACACCTCCCCAACTATGGGAGG + Intergenic
920116971 1:203628319-203628341 CGCTCTTCTCCAACTGGGTGTGG + Intronic
920870711 1:209792074-209792096 AACACTGGCCCAGCTGGGTGTGG - Intronic
921624458 1:217362857-217362879 TAAATTTCCACAACTGGGTGGGG + Intergenic
1069779890 10:70948622-70948644 TGGACTTCACCAACTGGGTGTGG - Intergenic
1071575896 10:86726088-86726110 CCCGCTGCCCCCACTGGGTGCGG + Intronic
1071981239 10:91006007-91006029 AACACTTCCACAGCTGGCTGAGG - Intergenic
1072497553 10:95977079-95977101 CACACCTCTCCAGCTGGGCGTGG + Intronic
1074375888 10:112940465-112940487 CACACATCCCCAGCAGGTTGTGG - Intergenic
1074443469 10:113498748-113498770 CAATCTGCCCCAACTGGGTGTGG - Intergenic
1074974618 10:118569960-118569982 CCCCCTTCCCCATCAGGGTGAGG + Intergenic
1074975001 10:118572851-118572873 CCCCCTTCCCCATCAGGGTGAGG + Intergenic
1080671810 11:34386236-34386258 CACACGTTCCCCACAGGGTGGGG - Intergenic
1081743614 11:45457919-45457941 CACACTTCCCAACATGAGTGGGG + Intergenic
1081830439 11:46107057-46107079 CACTCATCTCCAAGTGGGTGTGG + Intronic
1081886446 11:46501235-46501257 CACACTTCCCCATGTCTGTGTGG + Intronic
1084651371 11:70491342-70491364 GACACCCCCCCAACTTGGTGGGG + Intronic
1084773009 11:71356664-71356686 CACCCCTACCCCACTGGGTGAGG - Intergenic
1087151341 11:94862187-94862209 CAGACTACCCCTTCTGGGTGGGG + Intronic
1089901414 11:121989838-121989860 CAACCTACCCCAAGTGGGTGGGG + Intergenic
1090076094 11:123580836-123580858 CACACCTCCCCACCGCGGTGCGG + Intronic
1100750724 12:97695856-97695878 AGAACTTCCCCAACTGAGTGAGG - Intergenic
1104472955 12:129045332-129045354 CACACCTCCCCTCCTGGGGGTGG - Intergenic
1105016771 12:132790700-132790722 CACACTTCCACAGTGGGGTGGGG - Intronic
1115784376 14:36807524-36807546 CACACTTCCACATGAGGGTGAGG + Intronic
1118711955 14:68526916-68526938 CAGGCTTCCCCTTCTGGGTGTGG + Intronic
1118995775 14:70834307-70834329 CAGGCTTCCACAATTGGGTGAGG + Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119211500 14:72835645-72835667 CACACATCCACAGCTGGGGGAGG + Intronic
1120240064 14:81939670-81939692 CACACTTAAGCAAGTGGGTGGGG + Intergenic
1121330803 14:93048656-93048678 CACTCTTTCCCAGCTGGGCGCGG + Intronic
1122856140 14:104561088-104561110 CACCCATCCCCACCTGGCTGGGG - Intronic
1123185188 14:106509809-106509831 CACACTTCCCAAAATGGGGTGGG + Intergenic
1127198300 15:56614667-56614689 CACATTTCCCCAACTGAGGCAGG + Intergenic
1131316774 15:91345917-91345939 CTGTCTTCCCCAAATGGGTGTGG + Intergenic
1132594531 16:742380-742402 CACATGTCCCCACCTGGATGCGG + Intronic
1132923031 16:2409734-2409756 CCCACTGCCTCAACTGGGTCTGG - Intergenic
1133275924 16:4638498-4638520 TTGACTTCCCCAGCTGGGTGGGG + Intronic
1134689064 16:16179046-16179068 CACACCTGCCCATCAGGGTGAGG + Intronic
1135727937 16:24871561-24871583 GAAACTTGCCCAGCTGGGTGCGG - Intronic
1136376169 16:29866431-29866453 CACACTTTCCTGGCTGGGTGTGG + Intergenic
1138353885 16:56362521-56362543 CACACTCTTCCCACTGGGTGTGG + Exonic
1139350531 16:66332308-66332330 GACACGTCCCCTCCTGGGTGGGG + Intergenic
1141154903 16:81590471-81590493 CTCGCTTCCCCAAGTGGATGTGG + Intronic
1141965841 16:87442474-87442496 CACAATGCCCCAACAGGGAGGGG + Intronic
1142707787 17:1707682-1707704 CACAGTCCCCCATCAGGGTGAGG - Exonic
1146578172 17:34012952-34012974 CCCACTTCCCCACCTGGCTCTGG + Intronic
1146696054 17:34909740-34909762 AACTCTGCCCCCACTGGGTGTGG - Intergenic
1147430988 17:40370705-40370727 AACTCTGCCCCAGCTGGGTGCGG + Intergenic
1148466506 17:47868237-47868259 CACACTTGCCCGAATGGGAGTGG - Intergenic
1151718622 17:75843813-75843835 CTCACTTCCGCTGCTGGGTGAGG - Intronic
1152273605 17:79340512-79340534 CACACCTCCCCAGCTGCATGGGG + Intronic
1152333094 17:79684898-79684920 CACATTTCCCCAGGTGTGTGGGG + Intergenic
1153297560 18:3562265-3562287 CACAGTTACCCAAGTGGCTGTGG + Intronic
1157274201 18:46298683-46298705 CTCACTTACCCACGTGGGTGAGG - Intergenic
1160399505 18:78599719-78599741 TACATTTCCTCAGCTGGGTGCGG - Intergenic
1161366384 19:3882029-3882051 CCCACTTCCTCATCTGGCTGAGG + Intronic
1163196845 19:15728016-15728038 CTCTCTTCCCCAACTAGGGGTGG + Exonic
1163766517 19:19166212-19166234 CCCACTTCCCAGCCTGGGTGGGG - Intronic
1165006414 19:32811342-32811364 CACACTTCCCCCGCAGGCTGTGG + Intronic
1165218646 19:34296422-34296444 CACACTTCCCAAGCTTGGGGTGG + Intronic
1167971146 19:53188162-53188184 CTCACTTCCCAGACGGGGTGGGG + Intronic
927861752 2:26564324-26564346 CACAGTTCCCCAACTCTGTTTGG + Intronic
929578798 2:43069049-43069071 TACACTGCCCCAAGTGGGTGAGG - Intergenic
931728264 2:65130794-65130816 CACCCATCCCCACCTGGGTTCGG + Intergenic
932453039 2:71827963-71827985 CACATGTCCCCAAATGCGTGTGG + Intergenic
933000637 2:76918009-76918031 CACCCTTCCCCTACTGGGGCAGG + Intronic
933774981 2:85766384-85766406 CAGTCTTTCCCAGCTGGGTGAGG + Intronic
934555699 2:95286007-95286029 AACACCTGCCCAACTGCGTGAGG - Intronic
937344814 2:121119051-121119073 AACACTTCCCTCACAGGGTGGGG - Intergenic
940365456 2:152843773-152843795 CCCACTGCCCCAACTGGTGGTGG - Intergenic
942449250 2:176098895-176098917 CGAACTCCCCCGACTGGGTGTGG - Intergenic
948326997 2:237132330-237132352 CACTGTTCCCCAGCTGTGTGAGG - Intergenic
1168811809 20:709742-709764 CACACTCCCACAGCTGGGGGCGG - Intergenic
1171979915 20:31620378-31620400 CACACCTCCACAACTCAGTGAGG + Intergenic
1172050940 20:32117519-32117541 CACACCTTTCAAACTGGGTGGGG + Intronic
1173311617 20:41901321-41901343 CACATATGACCAACTGGGTGCGG - Intergenic
1173870318 20:46337742-46337764 CACCCCTCCCCAACTGGGGCTGG - Intergenic
1175218851 20:57405600-57405622 CACACTTCCCAGATGGGGTGGGG + Intronic
1175465915 20:59191322-59191344 CCGGCTTCCCCACCTGGGTGGGG - Exonic
1178947611 21:36960872-36960894 AACACTGTCCCAACTGGATGTGG + Intronic
1181005608 22:20012087-20012109 CACACTTCCCCAACTGGGTGGGG - Intronic
1181658109 22:24318101-24318123 CTCACTTCCCAGACGGGGTGGGG + Intronic
1182451954 22:30427017-30427039 CCCACTCCCCGAACTGGATGTGG + Intronic
1183353710 22:37347583-37347605 CACACTGCCCCAAGAGGTTGAGG + Intergenic
950425644 3:12923529-12923551 CACACTTAGCCTCCTGGGTGTGG + Intronic
951781052 3:26362996-26363018 CACTCTGCCCCTACTGGGGGAGG - Intergenic
953253869 3:41270305-41270327 CACAGCTCCCCAGCTGGGTTGGG - Intronic
953514548 3:43577368-43577390 CTCACTTCCCAAACAGCGTGTGG + Intronic
956677565 3:71750627-71750649 CAGAGTTCCTCAGCTGGGTGTGG + Intronic
959941512 3:112086313-112086335 CACACTCCACCCACTGGGCGGGG - Exonic
961147818 3:124610293-124610315 CACAGTTCCCCAAGAGGATGGGG + Intronic
962959654 3:140298962-140298984 CACAGGTCCACCACTGGGTGAGG - Intronic
965449878 3:168824693-168824715 CACACTTTTCCAACTTGGTTAGG + Intergenic
967860117 3:194144436-194144458 TATACTTCCCCAACTGGGCCAGG + Intergenic
969136299 4:5031822-5031844 CTCACACCCACAACTGGGTGAGG - Intergenic
971447216 4:26763811-26763833 CACACTTGCCCAACTTTCTGTGG - Intergenic
985659443 5:1149132-1149154 CACAGTCCCCCTTCTGGGTGCGG - Intergenic
986313814 5:6572972-6572994 CACACTTACTCAACTGAGTCTGG - Intergenic
990329006 5:54706962-54706984 TATACCTCCCCAAGTGGGTGAGG - Intergenic
993173067 5:84445543-84445565 CACACTTCTACAACTGAGTAGGG + Intergenic
995931528 5:117452392-117452414 CACACTAGCCCACCTGGATGTGG + Intergenic
998153691 5:139771981-139772003 CACCCTTCCCCAGCCAGGTGAGG + Intergenic
998957200 5:147450831-147450853 GACACTTCAGCTACTGGGTGGGG + Intronic
999165448 5:149545525-149545547 CACACTTCCCAAGCTTGGGGTGG + Intronic
999737938 5:154526667-154526689 CACCCTTCCACAACACGGTGGGG - Intergenic
1000287132 5:159836557-159836579 AACACTGCCCCATCTGGGTTTGG + Intergenic
1002571621 5:180142953-180142975 CACACAGCCCCAAGTGGCTGAGG + Intronic
1003907900 6:10719666-10719688 CACGTTTCCCCTACTGGCTGTGG + Intergenic
1006313877 6:33279160-33279182 GCCCCTTCCCCAACTGGGGGTGG - Exonic
1007178148 6:39910309-39910331 CACACAGCTCCAACTGGTTGGGG - Intronic
1013028561 6:106306399-106306421 CAGAGTTCCTCAACTGGGGGCGG + Intronic
1015788804 6:136945584-136945606 CACTCATCCCCAGCTGGGTTAGG + Intergenic
1016083637 6:139885541-139885563 CATAATTCCCCAAATGGGGGGGG - Intergenic
1017154177 6:151308163-151308185 CACTCTTCCACAGCTGGGCGTGG - Intronic
1022523981 7:31025668-31025690 CACCCTGCCTCAATTGGGTGGGG + Intergenic
1024658670 7:51473290-51473312 CACACTTCACTAGCTCGGTGAGG - Intergenic
1025036295 7:55594330-55594352 CACAGTACCCTAACTGGGAGAGG - Intergenic
1026848113 7:73708838-73708860 CACTCCTCCCCATCTGGGTCTGG - Intronic
1029091620 7:98052659-98052681 ACCATTTCCCCAGCTGGGTGAGG - Intergenic
1032839642 7:135703884-135703906 CCTTCTTCCCAAACTGGGTGAGG + Intronic
1033778490 7:144641357-144641379 CACAGTTCCCCAGCTGGAGGTGG - Intronic
1035209846 7:157319737-157319759 CACACTTCTCCAAATGGAAGGGG - Intergenic
1039583655 8:38687266-38687288 CAGACTCACCCAACTGGCTGGGG + Intergenic
1041342905 8:56865004-56865026 CAGACTTCCCAAACTGGGTGAGG + Intergenic
1045694091 8:104788305-104788327 CACATTGCCCCCACAGGGTGTGG + Intronic
1049017492 8:139931067-139931089 CAAACTGCCCCAAAGGGGTGAGG + Intronic
1050261137 9:3842181-3842203 AAGACTTCCCCAGCTGGGTGCGG + Intronic
1051132014 9:13873076-13873098 CACACTTCACCACCTGGGCGCGG - Intergenic
1053446889 9:38159436-38159458 GACACTTCCACAGCAGGGTGTGG + Intergenic
1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG + Intronic
1062286381 9:135774848-135774870 CCCCCTTCCACACCTGGGTGAGG + Intronic
1062444159 9:136586451-136586473 CACACTTGCACACCTGCGTGTGG - Intergenic
1062555737 9:137112711-137112733 CACACTTGCCCATCTGGGGCCGG + Intronic
1195492538 X:105488194-105488216 CACACTTGACCAATAGGGTGTGG + Intronic
1202073652 Y:21017166-21017188 CACATTTTCCCACATGGGTGTGG + Intergenic
1202078352 Y:21059020-21059042 CACATTTTCCCACATGGGTGTGG + Intergenic