ID: 1181006126

View in Genome Browser
Species Human (GRCh38)
Location 22:20014570-20014592
Sequence AGCTGGGCCTTGGGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 434}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181006126_1181006135 1 Left 1181006126 22:20014570-20014592 CCCAGGACCCCCAAGGCCCAGCT 0: 1
1: 0
2: 1
3: 43
4: 434
Right 1181006135 22:20014594-20014616 GTGCTCTGCAGTGCTGTCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 240
1181006126_1181006138 22 Left 1181006126 22:20014570-20014592 CCCAGGACCCCCAAGGCCCAGCT 0: 1
1: 0
2: 1
3: 43
4: 434
Right 1181006138 22:20014615-20014637 GGACCCCCACCCTCCATTCCTGG 0: 1
1: 0
2: 1
3: 32
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181006126 Original CRISPR AGCTGGGCCTTGGGGGTCCT GGG (reversed) Intronic
900115628 1:1026682-1026704 CGCTGGGCTTCGGGGGCCCTGGG - Intronic
900417538 1:2542041-2542063 AGCTGGGCCCTGGGTTTCCATGG - Intergenic
900543096 1:3213804-3213826 GGCTTGGCCTCGGGAGTCCTTGG - Intronic
900598030 1:3491251-3491273 TGCTGGGCGTGGGGAGTCCTGGG - Intronic
900752187 1:4405557-4405579 GACAGGGCCTTGGGGGGCCTGGG + Intergenic
900759901 1:4463545-4463567 AGTGAGGCCTTTGGGGTCCTTGG - Intergenic
901017067 1:6237992-6238014 AGCTAGGCCTTGGGGCCCTTGGG + Intergenic
901405557 1:9042738-9042760 AGCTGGGGGCTAGGGGTCCTGGG - Intronic
901491084 1:9596665-9596687 ATCTGGGCCTTTGGGTTCCATGG + Intronic
901636217 1:10671489-10671511 AGCCCAGCCCTGGGGGTCCTAGG - Intronic
901658011 1:10781627-10781649 AGCCTGGCCTTGGGGGTCTCTGG + Intronic
902222634 1:14976675-14976697 AGATGGGCATTGGCCGTCCTGGG + Intronic
902443964 1:16449742-16449764 AGGTGGGCGCTGGGAGTCCTGGG + Intronic
902482433 1:16718878-16718900 AGCCCGGCCTGGTGGGTCCTAGG + Intergenic
903070864 1:20726480-20726502 AGCTGGGCATTGCGGGGCCCTGG - Intronic
903730227 1:25488298-25488320 ACCTTGGCCTTGGGAGTGCTGGG + Intronic
904009713 1:27382792-27382814 CGCTGGGGCTTGGGGATCCAGGG - Intronic
904260341 1:29284205-29284227 AGTTGGGCCTTGGGGGTGATGGG + Intronic
904310843 1:29628591-29628613 AGATGGGTCTTGGGTGGCCTGGG + Intergenic
904328954 1:29745478-29745500 AGCCGGGCCCTGGGGGGCTTCGG - Intergenic
904420606 1:30388704-30388726 AGCTGGCTCTTGGGCGACCTGGG - Intergenic
904598077 1:31659135-31659157 AGCTGAGGCCTGGGGGTCCTGGG + Intronic
904600615 1:31670714-31670736 GTCTGGGGCTTGGGGGTCATGGG + Intronic
904635826 1:31880331-31880353 AACTTGGACTTGGGAGTCCTGGG - Intergenic
905248196 1:36629184-36629206 AGCTGGGCCCTGGGTCACCTTGG + Intergenic
905308913 1:37036324-37036346 AGCTAGGCCTTTTGGTTCCTTGG - Intergenic
908511942 1:64856700-64856722 AGCTGGGCCTCGGGGCTCCGTGG - Intronic
912574061 1:110648507-110648529 AGCTGGACCGTGAAGGTCCTTGG + Intergenic
912800992 1:112719628-112719650 TTTTGGGCCTTGGGGTTCCTAGG + Intergenic
913075057 1:115335231-115335253 AACTGAGGCTTTGGGGTCCTCGG - Intronic
913960263 1:143333851-143333873 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
914054619 1:144159424-144159446 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
914124527 1:144806937-144806959 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
914226173 1:145721167-145721189 AGTTGGGCCTGGTGGGTCCTGGG - Intronic
914756638 1:150565772-150565794 AGCTGGGCCTATGGGGTGCCTGG + Intergenic
915320016 1:155051402-155051424 CTCTGGGCCCTGGGGCTCCTGGG + Exonic
915447277 1:155980938-155980960 AGCTTGGGCTTGGGTATCCTCGG - Intronic
915540631 1:156563699-156563721 GGCAGGGTCTTGGGGGTTCTGGG - Intronic
915973981 1:160372902-160372924 GGGTGGGCATTGAGGGTCCTAGG + Intergenic
917231878 1:172846361-172846383 GGCCGGGCCTTGGGGATCCCTGG - Intergenic
917648214 1:177049207-177049229 TCCTGTGCCTTGGGGGTCCTGGG - Intronic
919758942 1:201084907-201084929 AGCTGGGGGTTGGGGGTTCCTGG + Intronic
919819685 1:201465336-201465358 GACAGGGCCTTGGTGGTCCTAGG - Intergenic
921929360 1:220742497-220742519 AGGTGGGCTCTTGGGGTCCTTGG - Intergenic
922786825 1:228287046-228287068 GGCTGGGCTTTGGGGCTGCTGGG - Intronic
923706340 1:236347878-236347900 GGTTTGGGCTTGGGGGTCCTGGG + Intergenic
923936436 1:238765346-238765368 AGCTGGGGGTGGGGGGTACTTGG + Intergenic
1063400780 10:5743274-5743296 ACCGGGGACTTGGAGGTCCTTGG + Intronic
1064181349 10:13118716-13118738 AGCTTGGCACTGGGGGTCCCAGG + Intronic
1067142831 10:43670693-43670715 AGCTGGAACTTGGGGGGCCCGGG - Intergenic
1067774501 10:49153203-49153225 AACTGGGTCTTGGGTCTCCTAGG - Intergenic
1067794494 10:49311049-49311071 GGCCGGGTCTTGGTGGTCCTGGG - Intronic
1067936769 10:50619529-50619551 AGAGGGGCCTGGGGGGTGCTGGG + Intronic
1068297809 10:55097362-55097384 AGCTGGGATTTGGGGGAGCTAGG + Intronic
1069678748 10:70268567-70268589 AGCTGGGGCTGGGAGGTCCAAGG + Intronic
1069830591 10:71280073-71280095 CTCTGGGCCTGGGGTGTCCTGGG - Intronic
1069912928 10:71770856-71770878 TGCTGGCCCTTGGGTGTCCCTGG + Intronic
1070130677 10:73653412-73653434 GGGTGGGCCTTGTGGGGCCTCGG + Exonic
1070402450 10:76065503-76065525 AGCTGGGCCATTGGGGAGCTGGG - Intronic
1071630426 10:87214770-87214792 AGATGAGCCTTTGGGGTTCTGGG - Intergenic
1071875409 10:89838054-89838076 CGCTGGGCCTGGGGCCTCCTGGG - Intergenic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1073328948 10:102658510-102658532 GGCTGGGCCTGGGAGGCCCTGGG - Intergenic
1074188624 10:111117010-111117032 GGCTGGGGATTGGGGGTCCAAGG + Intergenic
1075052159 10:119190541-119190563 AGCTGAGCCTTGGGATTCCAGGG - Intergenic
1075072358 10:119327518-119327540 AGCTGGGCCTATGGAGTTCTGGG - Intronic
1075654458 10:124152110-124152132 CGCTGGGCGGTGGGGGTCCTGGG + Intergenic
1075666463 10:124234124-124234146 TGCTTGGCTTTGGGGGTGCTGGG - Intergenic
1075902609 10:126055193-126055215 AGCTGGGATTTGGGGGCCGTGGG - Intronic
1075903650 10:126063072-126063094 TGCTGGGCCTTGGGGCACCCTGG - Intronic
1076332363 10:129679466-129679488 AGCTGTGCTTTGCGGGTCCCTGG - Intronic
1076372076 10:129962114-129962136 TGCTGGGCCTGGGTTGTCCTGGG - Intronic
1076379398 10:130014833-130014855 AGCTGGGAGCTGGGGGACCTGGG + Intergenic
1076490413 10:130857742-130857764 AGCTGACCCTTAGAGGTCCTGGG + Intergenic
1076759556 10:132595180-132595202 AGCTGGCCCCTGAGGGTCCGCGG - Intronic
1076858358 10:133128195-133128217 AGCTGCGGCTTGGGGGCCTTGGG - Intronic
1077037311 11:501679-501701 AGCTGGGGGCTGGGAGTCCTCGG - Intronic
1077178902 11:1203577-1203599 AACTGGACCTGGGGGGTCCTGGG - Intergenic
1077192503 11:1261297-1261319 ACATGGGCCTCTGGGGTCCTGGG - Intronic
1077194055 11:1270517-1270539 TCCTGGGCCTTGGGAGTCCCTGG + Intergenic
1077311239 11:1889923-1889945 GGCTGGGCCCTGGGGGGACTTGG + Exonic
1077538884 11:3137344-3137366 AGCTGGGCCCTGGGGGGCTTGGG + Intronic
1080823244 11:35826729-35826751 AGTGGGGGCTTAGGGGTCCTGGG - Intergenic
1081537163 11:44004457-44004479 AGCTTGGCCTTGGAAGCCCTGGG - Intergenic
1081597406 11:44468487-44468509 AGCTGGAGCTTGGGTGTCCTGGG + Intergenic
1083164609 11:60875833-60875855 AGTTGAGCCTTGGGGGACATTGG - Intergenic
1083308159 11:61771546-61771568 ATCTGGGCATTGAGGGTGCTGGG - Exonic
1083621554 11:64051814-64051836 AGCTAGGCCTTGAGGTCCCTGGG - Intronic
1083625975 11:64072160-64072182 GGCTGGGCCTGGGGGGACTTGGG + Intronic
1083641487 11:64148145-64148167 AGCAGGGCCCTGGGGATCCTTGG - Intronic
1083738638 11:64695868-64695890 AGCTGGGCTTTGGGGACCCATGG - Intronic
1083888314 11:65583516-65583538 ATCTGGGGCTTGGGGGGCCCAGG + Exonic
1083961009 11:66015136-66015158 ATATGGGCCTTGGGGGTGCTAGG + Intergenic
1084320375 11:68370206-68370228 AGCTGGGCCTTCTGAGCCCTGGG + Intronic
1084399269 11:68934288-68934310 AGCTGGGCATGGCTGGTCCTGGG + Intronic
1084546146 11:69816095-69816117 AGCCTGGCCCTGGGGGACCTGGG - Intronic
1084590777 11:70088830-70088852 AGCTGAGCCCTGGGAGTCGTTGG + Intronic
1084682711 11:70676314-70676336 CGCTTGGCCTTGGGTCTCCTTGG - Intronic
1085381183 11:76120204-76120226 ATCTGGGCTTTGTGGTTCCTTGG + Intronic
1085506977 11:77066511-77066533 CCCTGGCCCTTGCGGGTCCTCGG + Intergenic
1085521599 11:77142427-77142449 AGCTGGGCTTTGAGAGGCCTTGG + Intronic
1089398935 11:118153304-118153326 AGCGGTCCCTTGGCGGTCCTGGG - Intergenic
1089561722 11:119346555-119346577 AGTGGGCCCTTGGGGGTCTTGGG - Exonic
1090234625 11:125138598-125138620 CGCTGGGCCATGGGGGAGCTTGG - Intergenic
1090271359 11:125388591-125388613 AGCTGGGGCTTGAGGACCCTGGG - Intronic
1090376382 11:126292574-126292596 AGCTGAGGCTTGGGGGTAGTGGG - Exonic
1090560809 11:127929995-127930017 AGCAGGGACTCGGGGGGCCTTGG + Intergenic
1091548927 12:1523353-1523375 CGCTGGGCCTTTGGGATCCCTGG + Intergenic
1091591222 12:1843916-1843938 GGCTGGTCCTGGGTGGTCCTGGG + Intronic
1092070166 12:5625609-5625631 AGCTGGGGTTTGGGGGTTTTGGG - Intronic
1094870266 12:34595744-34595766 CCCTGGGCCTTGGGGATCCTGGG + Intergenic
1095985663 12:47997810-47997832 GGTGGGGCCTTGGGGGACCTGGG + Intronic
1096542991 12:52318574-52318596 TGCTGGGCCTGGGGAGTCCATGG + Intronic
1096652531 12:53068914-53068936 AGCTGGGCGTTCTGGGTCCCTGG - Intronic
1096845295 12:54403247-54403269 CACTGGGGCTTGGGGGTCCAAGG + Exonic
1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG + Exonic
1101027345 12:100624120-100624142 ACCTTGGCCTTGGGGGTATTGGG - Exonic
1101686700 12:107030924-107030946 AGCTGGGGGTTGGGGGTACCTGG + Intronic
1102492484 12:113297544-113297566 AGCTTGGCCTTGGAGGTGGTTGG - Exonic
1103322862 12:120101952-120101974 AGTGGGGCCTGGGGGGTCCGAGG - Intronic
1103581524 12:121918795-121918817 ACCTGGCCCTTGTGGGGCCTGGG + Intronic
1103983989 12:124755128-124755150 GGCTGGGCCTCGGGCGCCCTGGG - Intergenic
1104084077 12:125458494-125458516 AGTGGGGCCTTGCAGGTCCTGGG + Intronic
1104286690 12:127430748-127430770 AGTGGGGCCTTGCAGGTCCTGGG - Intergenic
1104463412 12:128972070-128972092 AGCTGTCCCTTGGGGATCTTGGG + Intronic
1104954037 12:132455073-132455095 AAGTGGGCCGTGGGGGTCCCAGG + Intergenic
1105804805 13:23946702-23946724 ATCTGAGCCTCAGGGGTCCTGGG - Intergenic
1107688531 13:42928445-42928467 ACCTTGCCCTTGGGGGTTCTTGG + Intronic
1107761572 13:43685074-43685096 AGCACAGCCTTGGGGATCCTGGG - Intronic
1112753339 13:102604062-102604084 AGCTGGGCGTGGGGATTCCTGGG + Intronic
1113492855 13:110706019-110706041 CGCTGGGCCTTGGGCGGGCTGGG - Exonic
1113596922 13:111540045-111540067 AGCGGTGCCCTGGGGGTGCTGGG - Intergenic
1113628413 13:111863552-111863574 GGCAGGGCCTTGTGAGTCCTGGG - Intergenic
1114495845 14:23131593-23131615 AGCTGGGGCTTGGTGGTCCCTGG - Intronic
1114632265 14:24166710-24166732 GCCTGGGCCCTGTGGGTCCTGGG + Exonic
1117963080 14:61181377-61181399 AGCTGCACCTTGGTGGTCCCTGG - Intergenic
1118412806 14:65500310-65500332 AGCTTTGCCTTTGGGGTTCTGGG + Intronic
1119738931 14:77001301-77001323 GGCTGGGCCTTGGGTCTCCATGG - Intergenic
1122814704 14:104306758-104306780 AGCGGGGCCCTGGGAGTCCAGGG + Intergenic
1122893252 14:104742695-104742717 AGCTTGGCTTTGGGGGTCAGGGG - Intronic
1122919963 14:104875988-104876010 CGCTGGGCCGTGGGAGTGCTGGG - Intronic
1123134661 14:106016212-106016234 AACTGAGCCTTGGGGGCCTTTGG + Intergenic
1202902806 14_GL000194v1_random:53013-53035 ATCTGAGCCTCAGGGGTCCTGGG + Intergenic
1123584638 15:21746338-21746360 AACTGAGCCTTGGGGGCCTTTGG + Intergenic
1123621283 15:22188945-22188967 AACTGAGCCTTGGGGGCCTTTGG + Intergenic
1123710026 15:22980294-22980316 CGCGGCGGCTTGGGGGTCCTGGG + Exonic
1124037653 15:26070938-26070960 TGCAGGGCCTTGGGAGGCCTGGG - Intergenic
1124348881 15:28941255-28941277 AGCTGGGCGCTGGTGGCCCTGGG + Intronic
1125592062 15:40860852-40860874 AGCTGGGCAGTGGAGATCCTGGG + Intergenic
1125920825 15:43524672-43524694 TCCTGGGCCTGGGGGCTCCTGGG - Exonic
1126696033 15:51326269-51326291 AGCTGGGCCTTGGGAGGTCCAGG - Intronic
1126802409 15:52310873-52310895 TACTGGGCCTTGGGGTTCCCTGG + Exonic
1127184209 15:56461255-56461277 GACTGGGCCTTGGGGTTTCTAGG - Intronic
1127773258 15:62246999-62247021 AGCTGGGGCTGGGGTGACCTGGG - Intergenic
1127774573 15:62255011-62255033 AGCTGGGGCTGGGGTGACCTGGG - Intergenic
1127899397 15:63329949-63329971 GGCTGGGCCCTGGGGGTTCCTGG + Intronic
1128551698 15:68601745-68601767 AGCTGGGGCTTAGTGGTGCTGGG + Intronic
1129125846 15:73440744-73440766 AGCAGGGCCCTGGGTGTCCTTGG + Intergenic
1129666093 15:77580149-77580171 AGCAGGGACTTGGGGGTGCTAGG - Intergenic
1130912623 15:88281522-88281544 AGCTGGGGCTTGGCTCTCCTGGG + Intergenic
1131462587 15:92629078-92629100 AGCACAGCCTTGGCGGTCCTTGG - Intronic
1131464711 15:92645904-92645926 AGCTGGGCCTTGGGGCTGGGTGG - Intronic
1132178145 15:99731955-99731977 AGCTGGGCCTTGGAAGGTCTTGG + Exonic
1132230906 15:100183316-100183338 AGCTGGGCCTTAGGGATCTGTGG - Intronic
1132556210 16:573833-573855 AGCTGGGCCTGGGGTGGACTTGG + Intronic
1132570363 16:641580-641602 AGGTGGGCCCTGGGGCTCCGAGG + Intronic
1132735591 16:1384302-1384324 AGCTGGGCTGTGTGTGTCCTTGG - Intronic
1134207068 16:12247018-12247040 AGCAGGGCCTTGTAGGTCCCTGG + Intronic
1136584421 16:31174778-31174800 ACTGGGGCCTTGGGGGTCCTGGG - Intergenic
1136666817 16:31819628-31819650 GCCTGGGCCTTGGGGACCCTTGG + Intergenic
1137440741 16:48496947-48496969 AGGTTGGCCTTGGGGGTCAGCGG - Intergenic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1140873260 16:79126209-79126231 AGCTTGGGCTTTGGGGTGCTGGG + Intronic
1141161580 16:81632736-81632758 AGCTGGGAGGTGGAGGTCCTAGG + Intronic
1141202325 16:81907810-81907832 GGCTGGTCCTCGGGGTTCCTGGG - Intronic
1141239268 16:82250056-82250078 ATGTGGACCTTTGGGGTCCTAGG - Intergenic
1141764777 16:86051316-86051338 AGCTCGGCATTGGGGAGCCTTGG - Intergenic
1142026458 16:87816733-87816755 AGCTGTGCCTCTGGGGTCCGTGG - Intergenic
1142030492 16:87836092-87836114 AGCTGGGCCCAGGCGCTCCTCGG + Intronic
1142119029 16:88376913-88376935 GGCTGGGCCCTCGGGGGCCTCGG - Intergenic
1142147382 16:88498230-88498252 AGCTGGGCAGAGGGGGCCCTGGG + Intronic
1142184800 16:88689606-88689628 AGCTGGGCCTTGCTTGTCCTTGG + Intergenic
1142220800 16:88854044-88854066 GGCTGGGCAGTGGGGGGCCTGGG - Intronic
1143388250 17:6544917-6544939 AGCTCTGCCTTGGGGTCCCTGGG + Intronic
1143485374 17:7251321-7251343 AGCTGGGCCGCGGGGGCCCCGGG - Exonic
1144632554 17:16881553-16881575 ACCTGGGCCTCTGGAGTCCTCGG + Intergenic
1144665378 17:17098709-17098731 GGCTGGGGCTTGGGAGCCCTGGG - Intronic
1144738647 17:17568963-17568985 GGCTGGGCCTGGGGTTTCCTGGG - Intronic
1144946406 17:18971667-18971689 AGCGGTACCTAGGGGGTCCTGGG + Exonic
1146655183 17:34630822-34630844 GGCTGGGCTGTGGGGGACCTGGG - Intronic
1146843054 17:36168026-36168048 AGCGGGGCCTGGGGAGCCCTGGG - Intronic
1146855359 17:36255967-36255989 AGCGGGGCCTGGGGAGCCCTGGG - Intronic
1146865262 17:36332408-36332430 AGCGGGGCCTGGGGAGCCCTGGG + Intronic
1146871265 17:36379878-36379900 AGCGGGGCCTGGGGAGCCCTGGG - Intronic
1146878625 17:36430960-36430982 AGCGGGGCCTGGGGAGCCCTGGG - Intronic
1146882573 17:36452106-36452128 AGCGGGGCCTGGGGAGCCCTGGG - Intergenic
1147068122 17:37933002-37933024 AGCGGGGCCTGGGGAGCCCTGGG + Intronic
1147074151 17:37980502-37980524 AGCGGGGCCTGGGGAGCCCTGGG - Intronic
1147079652 17:38012557-38012579 AGCGGGGCCTGGGGAGCCCTGGG + Intronic
1147085673 17:38060040-38060062 AGCGGGGCCTGGGGAGCCCTGGG - Intronic
1147095593 17:38136499-38136521 AGCGGGGCCTGGGGAGCCCTGGG + Intergenic
1147101620 17:38184006-38184028 AGCGGGGCCTGGGGAGCCCTGGG - Intergenic
1147135566 17:38432071-38432093 AGCTGGGCATGGGGCGCCCTGGG - Intronic
1147170157 17:38613686-38613708 AGCTCTGCCTTAGAGGTCCTTGG - Intergenic
1147366145 17:39960551-39960573 AGATGGGCTTTGCAGGTCCTTGG + Intergenic
1147568438 17:41552109-41552131 AGCTGGGCCTCGTCTGTCCTGGG - Intergenic
1147602495 17:41755034-41755056 ACCTGGGCCCTGGAGGCCCTGGG + Exonic
1147656177 17:42092497-42092519 AGGAGGCCCTTTGGGGTCCTAGG + Intergenic
1147735363 17:42634039-42634061 ATCTTGGCCTTGGGAGTCCAAGG + Intergenic
1148693260 17:49545052-49545074 GGCTGGGCCTTGGAGCTCCCAGG + Intergenic
1148703729 17:49609414-49609436 AGCCAGGTCTTGAGGGTCCTCGG + Intronic
1148783102 17:50132540-50132562 AGCAGGGCCTTGGTGGCCCTGGG + Intergenic
1148889482 17:50797706-50797728 AGCTGGGCCTCAGGGCCCCTCGG + Intergenic
1149102907 17:52927801-52927823 ACGTGGGCTTTGGGGGTCATGGG - Intergenic
1149846218 17:60010512-60010534 AGCGGGGCCTGGGGAGCCCTGGG - Intergenic
1150084567 17:62267092-62267114 AGCGGGGCCTGGGGAGCCCTGGG - Intergenic
1150333146 17:64310692-64310714 AGCTGGGCCTGGGGAGTTCCAGG - Intergenic
1151876365 17:76869866-76869888 CGCTGGGCCCTGGGGGCCCCTGG - Intronic
1151971334 17:77458999-77459021 AGGAGGGCCTTGGGGGCCATGGG + Intronic
1152066883 17:78117046-78117068 AGTGGGGCCCTGCGGGTCCTTGG + Intronic
1152088929 17:78236487-78236509 AGCTGGGACTGGGGGGCCCTCGG - Intronic
1152217734 17:79044176-79044198 GCCTGGGCCTTGGGGCCCCTGGG + Intronic
1152625012 17:81384081-81384103 AGCTGGGTGTCGGGGGGCCTGGG + Intergenic
1152717814 17:81908336-81908358 AGCTGTGCCTTTGGAGCCCTGGG + Intronic
1152760769 17:82105976-82105998 AGGTGGGCCCTCGGGGGCCTGGG + Intronic
1153386367 18:4501974-4501996 AGCTGGGCCCTTGGGACCCTGGG - Intergenic
1154502494 18:15003734-15003756 GGCTGGGCATTGGTGGTCCCCGG - Intergenic
1156957843 18:42990411-42990433 AACTGGGCCATGGGGTGCCTAGG - Intronic
1157092390 18:44651594-44651616 AGCTGGGCCTTGGGAGTGGCAGG - Intergenic
1157723680 18:49945779-49945801 AGCTGGGCCTGGGGGCTCCATGG + Intronic
1157870590 18:51226920-51226942 AGCTGCCTCTTGGGGGTTCTCGG - Intergenic
1157883641 18:51345514-51345536 AGCTGGACCTTGCGGCTCCTTGG + Intergenic
1157914946 18:51655396-51655418 GGCTGGGCCTGGGTTGTCCTGGG + Intergenic
1158559889 18:58505007-58505029 AGTCAGGCCTTGGGGGACCTGGG + Intronic
1158876877 18:61742633-61742655 TGCTGGGCCCTGGGTCTCCTGGG - Intergenic
1159023375 18:63161271-63161293 AGCAGTGCCTTGGGCTTCCTTGG + Intronic
1159899969 18:74036721-74036743 AGCAGGACCCTGGGTGTCCTAGG - Intergenic
1160187395 18:76686208-76686230 ATCTGGTCCTTGGGGTTGCTGGG + Intergenic
1160496790 18:79380677-79380699 AGCTGTGCCGGGGGGGCCCTTGG - Intergenic
1160873542 19:1287275-1287297 GCCGGGGCTTTGGGGGTCCTGGG + Intronic
1161041632 19:2113531-2113553 AGCTGGGCCTTGCAGAGCCTGGG + Intronic
1161050454 19:2161096-2161118 AGGAGGACCCTGGGGGTCCTAGG - Intronic
1161405185 19:4087597-4087619 AGCCAGGCCTTGGGGGGCCCTGG - Intergenic
1161534722 19:4811956-4811978 AGCAGGGCCTGGTGGGTCATGGG - Intergenic
1161684610 19:5696591-5696613 AGCCGAGCCTTCCGGGTCCTAGG - Intronic
1161942699 19:7415549-7415571 CCATGGGCCTTGGGGGCCCTTGG - Intronic
1162391625 19:10393501-10393523 AGCTGTGGCTGGAGGGTCCTGGG - Intronic
1162536431 19:11265223-11265245 TGCTGGGCCTTGTGGGTTGTGGG - Intergenic
1162910924 19:13847487-13847509 TGCTGGGACCTGGGGGTCCCTGG + Intergenic
1163235991 19:16031088-16031110 AGCTCAGCCTCGAGGGTCCTGGG + Intergenic
1164590891 19:29506215-29506237 AGAAGGGCCCCGGGGGTCCTGGG - Intergenic
1165118965 19:33546914-33546936 AGCTGGGCCTTGGTGGCATTTGG - Intergenic
1165232365 19:34395133-34395155 AGCTGGGATTTGGGGAACCTTGG - Intronic
1165445804 19:35856312-35856334 GGCTGGGACTGCGGGGTCCTGGG + Intronic
1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG + Intronic
1166420194 19:42630690-42630712 AGTGGGGATTTGGGGGTCCTGGG - Intronic
1166663558 19:44663163-44663185 AGCTGGGCCTCCTGGGTCTTGGG - Exonic
1167246035 19:48373762-48373784 AGCTCTGGGTTGGGGGTCCTGGG - Intronic
1167342136 19:48922244-48922266 GGCTGGGCCTCTGGGGTCCTGGG + Intronic
1167642764 19:50690888-50690910 AGGGGAGCCATGGGGGTCCTGGG - Intronic
1168277946 19:55287371-55287393 AACAGGGCCTAGGGGGACCTGGG + Intronic
1202694100 1_KI270712v1_random:112102-112124 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
927630376 2:24768335-24768357 TGCTGGGCCTGGGGGGTCTGTGG - Exonic
927698266 2:25251984-25252006 AGTGGGGCCTTGGGGCTCGTGGG + Intronic
928196451 2:29219809-29219831 AGCTGGAGCTTGGGATTCCTGGG + Intronic
928541447 2:32288145-32288167 AGTTATGTCTTGGGGGTCCTGGG + Intronic
929234778 2:39594216-39594238 ACCTGGGCTTTGGGGTTGCTAGG - Intergenic
929924328 2:46196380-46196402 TGCTGGGGGTTGGGGGTCCTAGG + Intergenic
930177497 2:48315173-48315195 AGCCGAGCCCTGAGGGTCCTTGG - Intronic
932236442 2:70124523-70124545 AGCTGGGATTTGGGGTTCCACGG + Intergenic
932573707 2:72951365-72951387 AGCTGGGCCTTAGGGTGCCCGGG - Intronic
932708581 2:74046417-74046439 TGCTGGGGACTGGGGGTCCTTGG + Exonic
933378130 2:81507282-81507304 AGGTGAGACTTGGGGGTCGTGGG + Intergenic
933633024 2:84677812-84677834 AGCTGAGTCTTGGGGATGCTGGG + Intronic
933877106 2:86630574-86630596 AGTTGGGCCCTGGGGCCCCTGGG + Intronic
933952460 2:87342473-87342495 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
934236700 2:90238810-90238832 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
934717669 2:96552878-96552900 AGATGGGGATTGGAGGTCCTGGG + Intergenic
938073536 2:128320304-128320326 AGCAGGGGCTTTGGGGCCCTAGG - Intergenic
938165343 2:129021145-129021167 GGCTGGGCCTTGGGCCTCCCTGG + Intergenic
938315027 2:130319182-130319204 ATCTGAGCCTCGGGGATCCTGGG - Intergenic
938932032 2:136095024-136095046 AGCTGTGCCTTGGCTGTCGTTGG + Intergenic
942249490 2:174035172-174035194 TGCTGGGACGTGGGGGACCTGGG + Intergenic
943524857 2:189003987-189004009 CGCTGGGACCTGGGGGTCCTGGG - Exonic
944704441 2:202274796-202274818 AGCTGGAGCTATGGGGTCCTAGG - Intronic
945405769 2:209446984-209447006 AGGTTGGCCTTAGAGGTCCTAGG - Intronic
946404920 2:219487121-219487143 AGCTGGGCCATGGGGGTGGTGGG - Intronic
946419690 2:219557841-219557863 AGCTGAGGCTTGGGGCTCCGGGG + Exonic
947634346 2:231672640-231672662 AGCTGGGCCACGGGGACCCTGGG + Intergenic
948293473 2:236844468-236844490 ACCTGGGGCTTGGGAGTGCTCGG + Intergenic
948623312 2:239250438-239250460 AGCTGGGCCGTGCGGGGCCCTGG - Intronic
948844522 2:240676766-240676788 AGGTGGGCCGCGGGGCTCCTGGG + Intronic
948844545 2:240676861-240676883 AGCTGGGCCTCAGGGTTCTTGGG - Intronic
948849315 2:240698018-240698040 AGCTGGGCCTCAGGGTTCTTGGG + Intronic
948849338 2:240698113-240698135 AGGTGGGCCGCGGGGCTCCTGGG - Intronic
1169084936 20:2820820-2820842 AGCTGGCCCTTGGAGGTTCCTGG - Intergenic
1170967325 20:21085294-21085316 AGCTGGGCCATGGTTGTCCAGGG + Intergenic
1171265726 20:23771063-23771085 AACTTGGCATTGGGGGTACTGGG - Intergenic
1172009097 20:31836168-31836190 GTCTGGGGCTTGGGGGTCCTGGG + Intergenic
1172699759 20:36845832-36845854 AGCTGGGGGTGGGGGGCCCTGGG + Intronic
1173192096 20:40884549-40884571 AGCTGGGCCTGGGGTGGCCGTGG - Intergenic
1173521526 20:43703617-43703639 CGCAGGGCCTTGGTGGGCCTAGG + Intronic
1174186500 20:48709944-48709966 AGCTGGGCCTTGGGAATCTTAGG - Intronic
1174393908 20:50234278-50234300 GGCTGGGCAGTGGGGGGCCTAGG - Intergenic
1174637664 20:52016006-52016028 AGGTGGCCCTTGTGGGCCCTGGG - Intergenic
1174657026 20:52180168-52180190 AGCTGGGTCTTGGTGTTGCTAGG - Intronic
1175501941 20:59456803-59456825 TGTTGGGCCATGGGGGGCCTGGG - Intergenic
1175795155 20:61766360-61766382 GGCTGGGCCAAGGGGGGCCTAGG - Intronic
1175883206 20:62272258-62272280 AGGTGGGCCTTAGGGGTGCCAGG + Exonic
1175909298 20:62397008-62397030 AGCTGGGCATTGGGGCACCATGG + Intronic
1176413259 21:6460116-6460138 CCGTGGGCCTGGGGGGTCCTGGG - Intergenic
1176622172 21:9067780-9067802 ATCTGAGCCTCAGGGGTCCTGGG + Intergenic
1178643585 21:34366230-34366252 GGATGGGCCTTAGGGGTCCCAGG + Intronic
1179248734 21:39655742-39655764 GGCTGGGCCTTTGGAGGCCTGGG - Intronic
1179688756 21:43068438-43068460 CCGTGGGCCTGGGGGGTCCTGGG - Intronic
1180048339 21:45319973-45319995 ACCTTGGCCTGGGGGGACCTGGG + Intergenic
1180079554 21:45480576-45480598 AGCTGAATCTTGGGGGTCCATGG - Intronic
1180258226 21:46648959-46648981 TGCTGGGCCTTGGGTGTGGTTGG + Intronic
1180845027 22:18976175-18976197 GGCTGGCCCTTGGTGGTCCCAGG + Intergenic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181056440 22:20262569-20262591 GGCTGGCCCTTGGTGGTCCCAGG - Intronic
1181645769 22:24231285-24231307 AGCTGGGCCTTGGCTGGGCTTGG + Intronic
1181953856 22:26574081-26574103 TGCAGGGCTTTGGGGGACCTGGG + Intronic
1182312086 22:29416364-29416386 AGGGGGGCATAGGGGGTCCTAGG + Intronic
1182688174 22:32136879-32136901 AGGGGGGCATAGGGGGTCCTAGG - Intergenic
1182695769 22:32198488-32198510 AGGGGGGCGTAGGGGGTCCTAGG + Intronic
1182769010 22:32780267-32780289 AGCTGGCCCTGGGGGGTGCCGGG + Intronic
1183023525 22:35046450-35046472 AGCTGGGACATGGAGATCCTGGG - Intergenic
1183073802 22:35413930-35413952 AGCTGGGACTTGGCTGTCCCAGG - Exonic
1183220044 22:36506586-36506608 AGCTGGGACTTGGGGCTCCCCGG + Intronic
1183284011 22:36951499-36951521 GGCAGGGCCCTGGGGGTGCTGGG + Intergenic
1183333113 22:37231897-37231919 GGGTGGGCCTTGGGGGCTCTGGG - Intronic
1183541905 22:38434288-38434310 AGCTCAGCCTTGGGGATCCGAGG + Intronic
1183700098 22:39446266-39446288 AGCTGGGCCTCGAGCCTCCTGGG - Intergenic
1183950761 22:41351463-41351485 AGCTGGGCCTCGGGGGTCCCTGG + Intronic
1184198782 22:42950820-42950842 CGCTGGGCCTGTGGGGTCCCGGG + Intronic
1185162396 22:49237846-49237868 TGCTGGACCGTGGGGGCCCTGGG - Intergenic
1185230684 22:49678729-49678751 GGCTGGGCCGTGGGGTGCCTGGG - Intergenic
1185272147 22:49934635-49934657 AGGTGGGCCCTGGGGGTCGGGGG + Intergenic
950541373 3:13615226-13615248 ACATGGGCCTTGGTGGCCCTGGG + Intronic
952531432 3:34266190-34266212 AGCTGGGATTTTGGAGTCCTGGG + Intergenic
954146853 3:48638793-48638815 AGCAGGGGTTTGGGGATCCTGGG - Intronic
954369000 3:50160578-50160600 TGCTGGGGCCTGGGGGACCTGGG + Intronic
954378144 3:50205558-50205580 AGCAGGGCCCTGGGGGTACCGGG + Intronic
954402131 3:50324483-50324505 AGCTGGGCCTTTGAGGTCCATGG + Intronic
954497853 3:50982634-50982656 AGCTGGGCCTGGGCAGTGCTAGG + Intronic
954704709 3:52473263-52473285 ATCTGGGTCTTGGGTGTGCTTGG + Intronic
955397255 3:58566207-58566229 AGCGGGGCCCTGGGGAGCCTCGG + Exonic
960115077 3:113885250-113885272 AGCTGGGCCGTGGGGGCCTCCGG + Intronic
960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG + Intronic
962312591 3:134337019-134337041 AGCTGGGCCTTGGTGGGGATGGG + Intergenic
962353298 3:134672084-134672106 AGATGGGGTTTGGCGGTCCTTGG - Intronic
962826316 3:139103221-139103243 AGCTGGCCTTTGGGGCTGCTTGG + Intronic
964526146 3:157616800-157616822 AGCTGGGCCTGAGGGGGCCCAGG - Intronic
967269620 3:187722313-187722335 AGCTGGGGGTTGGGGGTGGTGGG - Exonic
967619503 3:191615870-191615892 TGTTGGGTGTTGGGGGTCCTAGG + Intergenic
968392677 4:205780-205802 AGTGGGGTCCTGGGGGTCCTGGG - Intergenic
968450702 4:674742-674764 GGCAGGGACCTGGGGGTCCTGGG + Intronic
968814209 4:2813261-2813283 AGCTGGGCCGTGGCTGTGCTGGG + Intronic
968872443 4:3248698-3248720 GGCTGGGCCCTGGGGCTCCTGGG - Exonic
968911802 4:3480153-3480175 AGCTGGGCCTTGAGGGTGAATGG + Intronic
968942159 4:3644455-3644477 TGCTGGGCCTGGGGGGTGCTGGG + Intergenic
969100965 4:4767982-4768004 AGCTGGGCCCAGGGGGTTCAAGG + Intergenic
969575303 4:8033121-8033143 GGCTCTGCCGTGGGGGTCCTGGG + Intronic
971216073 4:24663204-24663226 AGCTGGGGTGTGGGGGACCTTGG + Intergenic
971231029 4:24800268-24800290 AGGGGGGCCTCGGGGGTCCCTGG - Exonic
971299846 4:25433005-25433027 AGCTGGGGCCTGGGTGTTCTAGG + Intergenic
973997656 4:56475467-56475489 AGCAGGGCCTAGGAGGGCCTAGG + Intronic
975060056 4:69986001-69986023 ACCTGGGCTTTGGGAGTCATGGG - Intergenic
976507411 4:85864252-85864274 AGCAAGGCCATGGGAGTCCTTGG - Intronic
976824850 4:89249328-89249350 AGTTGTGCCTTGGGGGCCCGAGG + Exonic
979014961 4:115420625-115420647 AGCTGGTTTATGGGGGTCCTAGG - Intergenic
981206431 4:142046395-142046417 AGCTTGGCCTTGGGGATTCATGG + Intronic
982198581 4:152938004-152938026 AATTCGGCCTGGGGGGTCCTGGG - Intronic
983077471 4:163343813-163343835 AGCAGGGTCTCGGGGGTCCCCGG + Intronic
983611386 4:169649142-169649164 AGCAGGGCATTGGAGGTGCTAGG + Intronic
985819022 5:2147420-2147442 AGCTGAGCCTTGGTGGCACTGGG - Intergenic
985997151 5:3603166-3603188 CGCTGGGCCTTGGGGCTCCGTGG + Intergenic
986337432 5:6766130-6766152 TGCTGCACCTTGGGGGTCTTGGG + Intergenic
992151642 5:73909942-73909964 GGGTGGGCCTGGGGGCTCCTAGG + Intronic
992565017 5:77987914-77987936 AGGTGGGCCCTGGGGGACCTAGG - Intergenic
994591958 5:101784481-101784503 ACCTGTGCCTTGGTGGTCCTGGG + Intergenic
996322250 5:122231983-122232005 AGCTGGGGCTTGCAGGTCATAGG + Intergenic
997473374 5:134129051-134129073 ATCTGGCCCTTTGGGGTTCTTGG - Intronic
997693602 5:135844300-135844322 GGCTGGGCCTTGGGGAGACTTGG + Intronic
997747245 5:136310091-136310113 AGCTGGGCCTTGGGAGGACTGGG - Intronic
998041182 5:138951867-138951889 ACCTGGACCTTGGGGTTGCTGGG + Exonic
998352058 5:141508282-141508304 AGGTGGGCCTTGGGGGGAGTGGG + Intronic
998352290 5:141509330-141509352 AGCTGGGCCTGGGCTGGCCTGGG + Intronic
999776312 5:154815337-154815359 AACTTGGCCTTGGGGTTCCAAGG - Exonic
1001437856 5:171714571-171714593 AGCTGGTCCTTGGCCATCCTTGG + Intergenic
1001773302 5:174311563-174311585 AGCTGGGCCTGGGGGGACAGGGG + Intergenic
1002000956 5:176196005-176196027 AGCTGGGCCTGGGGTGCCCCGGG + Intergenic
1002253378 5:177942967-177942989 AGCTGGGCCTGGGGTGCCCCGGG - Intergenic
1002336777 5:178484950-178484972 TGCTAGGCACTGGGGGTCCTTGG - Intronic
1002779941 6:358199-358221 GGCTGGGCACTGGGTGTCCTGGG + Intergenic
1005066690 6:21825197-21825219 AGCTGGGAATTTGGAGTCCTGGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006743129 6:36323344-36323366 AGCTGGGCCTCTTGGGTCGTCGG + Exonic
1007449260 6:41930776-41930798 AGCTGGGGGTTCGGGGGCCTTGG + Intronic
1008872456 6:56288682-56288704 AGCTGGCCCTCGGGCTTCCTTGG - Intronic
1009836913 6:69013069-69013091 AGCTGTGACTTGGGGGTCACAGG - Intronic
1015707763 6:136107103-136107125 AGATGGGCCTTGAGTGTACTTGG - Intronic
1016461805 6:144286056-144286078 AGCTCGGGCGTGGAGGTCCTTGG + Intronic
1018401239 6:163422713-163422735 AGCTGGGCTTTGTGAGTACTGGG + Intronic
1018754524 6:166837598-166837620 GGCTGGGGCTCTGGGGTCCTAGG + Intronic
1019178885 6:170175283-170175305 ACCTGGGCTGAGGGGGTCCTGGG + Intergenic
1019292154 7:256079-256101 AGCTGGGCCTGGGCGGGCATGGG + Intronic
1019745902 7:2700286-2700308 AGCTGGGCCTTAAGGGCCCTTGG + Exonic
1020100970 7:5394325-5394347 AGCTGGGGCTGGTGGGTCCCAGG - Intronic
1021422813 7:20464532-20464554 TGCTGGGCCTTGGGGATGCCAGG - Intergenic
1022495450 7:30850294-30850316 GGCTTTGCCTTGGGGCTCCTGGG + Intronic
1022516534 7:30978269-30978291 CCATGGGCCCTGGGGGTCCTGGG + Intronic
1022532998 7:31078768-31078790 AGCTGGACCTTGGGCTACCTGGG + Intronic
1023526543 7:41109428-41109450 ATCAGAGCCTTGGGGGTCCCTGG + Intergenic
1023866647 7:44241614-44241636 AGGGGGGCCTTGGGGGGTCTGGG - Intronic
1025868190 7:65405689-65405711 AGATGCGCCTTGGGGATCCTGGG - Intergenic
1026859055 7:73773229-73773251 AGCTGGGCCTTGGGGTTTTTTGG + Intergenic
1026934768 7:74247828-74247850 AGCTGTCCCTTGGTGTTCCTGGG + Intronic
1028173757 7:87629008-87629030 CGCGGGTCCTTGGGGGTCCCGGG + Intronic
1029550205 7:101233295-101233317 AGCTGGGCCATGGGAGTCCAGGG + Intronic
1030075406 7:105732552-105732574 GGAGGGGCCTTGGGGGTCCATGG - Intronic
1032092060 7:128915971-128915993 GCCTGGGCCTTGGGGTTCCCTGG + Intergenic
1033206463 7:139427238-139427260 AGTGGGGCCTTGGGGGCTCTAGG + Intergenic
1033422688 7:141217468-141217490 AGCTGGGCCTTGGCTGCCCCAGG + Intronic
1033660996 7:143401882-143401904 AGCTTTGCCTTGGGGGTACCTGG - Intronic
1035369277 7:158368716-158368738 AGCTGGGCCTTGGGTCTCTGAGG - Intronic
1035424452 7:158759062-158759084 TGCTGGGCCTTGGCGATCCGTGG - Intronic
1035670388 8:1412524-1412546 AGCTTGGCCTTGTGTATCCTTGG + Intergenic
1035760007 8:2062117-2062139 AGAGGTGCATTGGGGGTCCTGGG + Intronic
1036584639 8:10112108-10112130 AGCTGGGACTTGGGTGTCAGAGG - Intronic
1038412547 8:27369304-27369326 TGCTGGGCCTGGGGGATCCAGGG + Intronic
1039377669 8:37052481-37052503 ACATGGGCCTTTGGGGACCTTGG - Intergenic
1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG + Intronic
1044870850 8:96618509-96618531 ACCAGGGCCTTGGGGGATCTGGG + Intergenic
1045754933 8:105531371-105531393 ACAGGGGCCTTGGGGTTCCTTGG + Intronic
1048833212 8:138496352-138496374 ACCTTGGCCATTGGGGTCCTTGG - Intronic
1048986239 8:139736621-139736643 AGCTGTACCCTGGGGGTCCCAGG - Intronic
1049232144 8:141489940-141489962 TGGTGGGCAATGGGGGTCCTCGG + Intergenic
1049270123 8:141691165-141691187 AGATTGACCTTGGTGGTCCTTGG - Intergenic
1049386564 8:142345706-142345728 CGCTGGGTCTCAGGGGTCCTGGG - Intronic
1049758418 8:144320971-144320993 AGCTGGGCCTGAGGGGTGCAGGG - Intronic
1051612592 9:18975796-18975818 TGCTGGGCCTTGGGTTTTCTTGG - Intronic
1054947767 9:70814316-70814338 AGCTGGACTTTGGGGTGCCTAGG + Intronic
1057028727 9:91757108-91757130 AGCTGGGCCCTGGGGCACATGGG + Intronic
1057261874 9:93589078-93589100 CCCTGGACCTTGAGGGTCCTGGG - Intronic
1059359006 9:113724784-113724806 AGCTGGGAGTTGGGAGACCTGGG + Intergenic
1060661070 9:125405560-125405582 TGCTGGGGCCTGGGTGTCCTGGG + Intergenic
1061063207 9:128261146-128261168 AGCTGGGGCTGGGGTGACCTGGG - Intronic
1061140521 9:128763479-128763501 TGCTGAGCACTGGGGGTCCTTGG + Intronic
1061818139 9:133208235-133208257 GGATGGGCCATGGGTGTCCTGGG - Intronic
1061822719 9:133237418-133237440 AGCTGAGCCTTGGAGTTCCTGGG - Intergenic
1062027780 9:134348467-134348489 ACATGGGCCCTGGGGGACCTCGG - Intronic
1062129741 9:134885908-134885930 TGCTGGGGCTTGGGGGTCGGGGG + Intronic
1062207824 9:135346975-135346997 AGCTGGGCCTAGGGGTGCCGGGG - Intergenic
1062231992 9:135486942-135486964 AGCTGGGCCCTGGGACTCCCTGG - Exonic
1062236576 9:135513034-135513056 AGCTGAGCCTTGGAGTTCCTGGG + Intergenic
1062344764 9:136109619-136109641 AGCTGGGTCTTGGTGCTCCTGGG - Intergenic
1062436978 9:136550713-136550735 AGCTGGGCCTGGGGGGTGGCTGG + Intergenic
1062452171 9:136620391-136620413 GGCTGGGCCTTTGGGGTCTGTGG - Intergenic
1062601190 9:137319312-137319334 AGCTGGGCCTGCGTGGTCCCGGG + Intronic
1062612601 9:137381818-137381840 ATGGGGTCCTTGGGGGTCCTGGG - Intronic
1203745369 Un_GL000218v1:38210-38232 ATCTGAGCCTCAGGGGTCCTGGG + Intergenic
1203564739 Un_KI270744v1:81274-81296 ATCTGAGCCTCAGGGGTCCTGGG - Intergenic
1186179585 X:6959770-6959792 AGTTGGGCCTTGAAGGCCCTAGG - Intergenic
1186858920 X:13652296-13652318 AGCTGGGCCTTGGTGCTGCGTGG + Intergenic
1187259588 X:17672934-17672956 AACTGGGCCTTGGGAGGTCTTGG + Intronic
1189259316 X:39666893-39666915 AGCTGTGCCATGGAGGTCCCTGG + Intergenic
1189396718 X:40629419-40629441 AGCCCAGCCTTGGGGATCCTGGG + Exonic
1190108330 X:47574190-47574212 GGCTGGGCCTGGGGGTTTCTGGG + Exonic
1190274408 X:48891200-48891222 AGCTGGGGCTGGGGCGCCCTGGG - Intergenic
1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG + Intergenic
1192043069 X:67643632-67643654 AGCTGGGGCTTGGGGCTCAGTGG + Intronic
1192359129 X:70427228-70427250 AGCTGGGGCTTAGGGGATCTGGG + Intronic
1193148862 X:78104508-78104530 GGCTGGGCCCCAGGGGTCCTAGG + Intronic
1199234796 X:145479038-145479060 CGCTGGGCCATTGGGATCCTGGG + Intergenic
1200100378 X:153687124-153687146 AGGGAGGCCTGGGGGGTCCTGGG + Intronic
1201158688 Y:11153221-11153243 ATCTGAGCCTCAGGGGTCCTGGG + Intergenic
1202136303 Y:21668438-21668460 AGCTGTGCGTTGGGGGTCGGGGG - Intergenic