ID: 1181006914

View in Genome Browser
Species Human (GRCh38)
Location 22:20017826-20017848
Sequence TGCCCAGTGGGCTTTTCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181006897_1181006914 30 Left 1181006897 22:20017773-20017795 CCTCCGCCAGCTCTGCGTAACCT 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1181006914 22:20017826-20017848 TGCCCAGTGGGCTTTTCTAGGGG 0: 1
1: 0
2: 0
3: 18
4: 167
1181006900_1181006914 24 Left 1181006900 22:20017779-20017801 CCAGCTCTGCGTAACCTTGTGGT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1181006914 22:20017826-20017848 TGCCCAGTGGGCTTTTCTAGGGG 0: 1
1: 0
2: 0
3: 18
4: 167
1181006909_1181006914 -10 Left 1181006909 22:20017813-20017835 CCAGCAGGGATGCTGCCCAGTGG 0: 1
1: 0
2: 5
3: 29
4: 345
Right 1181006914 22:20017826-20017848 TGCCCAGTGGGCTTTTCTAGGGG 0: 1
1: 0
2: 0
3: 18
4: 167
1181006898_1181006914 27 Left 1181006898 22:20017776-20017798 CCGCCAGCTCTGCGTAACCTTGT 0: 1
1: 0
2: 1
3: 40
4: 112
Right 1181006914 22:20017826-20017848 TGCCCAGTGGGCTTTTCTAGGGG 0: 1
1: 0
2: 0
3: 18
4: 167
1181006906_1181006914 10 Left 1181006906 22:20017793-20017815 CCTTGTGGTGTAGGGGGGAACCA 0: 1
1: 0
2: 1
3: 62
4: 1070
Right 1181006914 22:20017826-20017848 TGCCCAGTGGGCTTTTCTAGGGG 0: 1
1: 0
2: 0
3: 18
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181006914 Original CRISPR TGCCCAGTGGGCTTTTCTAG GGG Intronic
902377387 1:16036251-16036273 TGCCCTGGGGGCTGTTCTCGGGG + Intergenic
902623517 1:17664040-17664062 TGACCAGTGGGGCTTCCTAGAGG + Intronic
902976600 1:20093067-20093089 TGATCAGTGGGCTTTACTTGAGG - Intergenic
903482889 1:23667296-23667318 TGCACAGTGGTGTTTTCTAGGGG - Intergenic
903571691 1:24310579-24310601 TCCCCAGTGGGCTTGTGTACAGG + Intergenic
909656989 1:78043619-78043641 TTCCCAGTGGGCTGGTCCAGTGG + Intronic
909772947 1:79447788-79447810 TGACCATTGTACTTTTCTAGGGG + Intergenic
910012185 1:82479151-82479173 TGTCCAGTGGGCTTTTGAAGTGG - Intergenic
913330114 1:117660015-117660037 TACCCAGTGGGCTTTGGAAGGGG - Intergenic
913338626 1:117734136-117734158 GGCCCAGTGGGCTTATTTGGGGG - Intergenic
915315451 1:155026242-155026264 TCCCCAGGGGGCTTAGCTAGTGG - Intronic
918043877 1:180929437-180929459 TGCCTGGTGGGCATTTCCAGTGG - Intronic
920201865 1:204264570-204264592 TGCCCAGAGGGATTTCCCAGGGG + Intronic
921886157 1:220308529-220308551 TGCCCAGGGGTCTTTTCTCTTGG + Intergenic
923366405 1:233266043-233266065 TGCCAAGTGGTCCTTTATAGAGG - Intronic
1064247396 10:13679963-13679985 TGCCTAGTGGGCATTTGTGGAGG - Intronic
1064558741 10:16574386-16574408 TGCCTAGTGGTCATTTCTATTGG - Intergenic
1071153817 10:82666774-82666796 TGCTCAGTTTGCTTTTCCAGAGG + Intronic
1076425063 10:130361781-130361803 TGGACAATGGGCTTTTCTTGGGG - Intergenic
1080133212 11:28820635-28820657 TGCTAAGTGGGCTTCTCTATAGG - Intergenic
1083310145 11:61779768-61779790 TCCCCAGTGGGCTCTGCTGGAGG - Intronic
1084645226 11:70452921-70452943 TGCCCACTGTGCTCTTCCAGGGG + Intergenic
1085254816 11:75166454-75166476 AGCCCAGTGGGATTTTGTTGAGG + Intronic
1086361100 11:86060498-86060520 TGTACAGTGGAGTTTTCTAGAGG - Intronic
1086916144 11:92532059-92532081 TGCACAGGGTGCTTTGCTAGGGG - Intronic
1087827792 11:102786111-102786133 GGTGCAGTGGGCTTTTCTGGTGG + Intergenic
1088814924 11:113414312-113414334 TGGCCAGTGGGCTTCCCTAGGGG + Intronic
1092419747 12:8321049-8321071 TGCCCAGTGGCCTATTTAAGAGG - Intergenic
1092830014 12:12434518-12434540 TGTCCAGTGGAGTTTTCCAGAGG + Intronic
1093362174 12:18242992-18243014 TGCCCTGTTGGCATTTCTACTGG + Intronic
1094055971 12:26269951-26269973 TGCCCAGTGGGCCTATCCTGGGG - Intronic
1097494674 12:60315789-60315811 TGCCCATAGGAATTTTCTAGTGG + Intergenic
1098361224 12:69656161-69656183 TGTCCAGTGGAATTTTCCAGAGG - Intronic
1101581670 12:106047543-106047565 TGGCCATTGGGCATTGCTAGCGG - Intergenic
1102357786 12:112253927-112253949 TGCCCTGGGGGCTTTTGTTGAGG - Intronic
1103443190 12:120978615-120978637 TGCCCACAGGGCTTGGCTAGTGG + Exonic
1104063851 12:125290044-125290066 TGCCGTGTGTGTTTTTCTAGTGG + Intronic
1112115831 13:96352419-96352441 TTCCCTGTGGGCCTTTCCAGAGG + Intronic
1112441111 13:99425897-99425919 GGCCCAGTGGGGTTTTTCAGGGG + Intergenic
1117306875 14:54486357-54486379 TGCCCAGTGTTTTCTTCTAGTGG - Intronic
1118359558 14:65044508-65044530 AGCCCAGCGTGCTTTTTTAGAGG + Intronic
1121174861 14:91883445-91883467 TGCCCACTGGGATTTTCTGGGGG + Intronic
1121516921 14:94558565-94558587 GGCCCAGTGGTATTTCCTAGGGG + Intergenic
1122287510 14:100660336-100660358 TGCTGAGAGGGCTGTTCTAGGGG + Intergenic
1125320625 15:38484312-38484334 TGCCAAGGGGGCATTTCTGGAGG - Exonic
1129769555 15:78194411-78194433 TGCCCAGTGGGCAGTTGGAGAGG + Intronic
1130001682 15:80053366-80053388 TGTACAGTGGAGTTTTCTAGAGG + Intergenic
1131526943 15:93160089-93160111 TGCCCAGGGGGCTTTGGTGGAGG - Intergenic
1131867077 15:96722514-96722536 TGCCCAGTAGCCTTTCCCAGGGG + Intergenic
1132975285 16:2708024-2708046 AGCCCTGTGGGCATTTCCAGAGG - Exonic
1133741529 16:8655399-8655421 TGCCATGTGGGCCTCTCTAGGGG + Intergenic
1136033504 16:27520528-27520550 GACCCTGTGGGCTTGTCTAGAGG - Intronic
1136058689 16:27709762-27709784 TGCTCTGTGGGTTTTTCTTGGGG + Intronic
1139524427 16:67505383-67505405 TGTACAGTGGGATTTTCCAGAGG + Intergenic
1140245263 16:73242644-73242666 TTCCCTGTGGGCTTTTCCAAGGG - Intergenic
1142433627 16:90043762-90043784 TGCCCAGTGGGATTCTCCAGGGG + Exonic
1143374970 17:6461988-6462010 CGCCCAGGAGGCTTTTGTAGTGG - Intronic
1145974757 17:28977676-28977698 TGTCCAGTGGGCTTCAGTAGGGG + Intronic
1146662211 17:34672385-34672407 TGCCCAGTGGCCTCTTCCATTGG - Intergenic
1148851025 17:50555417-50555439 TTCCCAGTGGGCCTTTCTAATGG + Intronic
1150001051 17:61440284-61440306 TGCCCAGAGGGCCTGTCTTGGGG - Intergenic
1150352550 17:64457231-64457253 TGCCCATTGGCCTTTCCCAGTGG + Intronic
1151513708 17:74578804-74578826 TGCCCAGTGGGATCATCTGGTGG - Intergenic
1153995024 18:10433367-10433389 TGTCCAGTGGTCTTTACAAGTGG - Intergenic
1155984999 18:32220585-32220607 TTCCCATTGGGTGTTTCTAGTGG - Intronic
1156376651 18:36520908-36520930 TGCTCAGTAGACTTTTCCAGAGG + Intronic
1157238590 18:45987685-45987707 ACCCCAGTGGGCTTATCTTGGGG - Intronic
1157276081 18:46311948-46311970 ACCCCAGTGGGCTTTTCTGCAGG - Intergenic
1160096091 18:75874978-75875000 TTCCCAGTGGGATTTGCTATGGG + Intergenic
1160877032 19:1301292-1301314 TGGGCAGAGGGCTTTTGTAGGGG + Intergenic
1161801698 19:6419896-6419918 TGCCCCGTGGGCAGTACTAGTGG + Intronic
1164537277 19:29095248-29095270 TGCCCTGCAGTCTTTTCTAGAGG - Intergenic
925413552 2:3654156-3654178 TGCCATGTGGGCCTCTCTAGAGG + Intergenic
928692277 2:33812356-33812378 TGTACAGTGGCCTTTTCTAAGGG + Intergenic
929390076 2:41459446-41459468 TGGCTAGTGGGATTTTCTGGTGG - Intergenic
929392735 2:41489982-41490004 TGCCATGTGGACCTTTCTAGAGG + Intergenic
930102319 2:47613007-47613029 TATCCAGTGGGCATTTCTAGAGG + Intergenic
930243309 2:48958046-48958068 TGTCCATTGGGCTTTTCTACTGG + Intergenic
930757620 2:54993326-54993348 TTCCCAGTAGGCTTTCCTATTGG + Intronic
932448500 2:71794976-71794998 AGCCCTGAGGGCTTTTCCAGAGG + Intergenic
933306752 2:80609955-80609977 TGCACTGTTGGCTTTTATAGAGG + Intronic
936482536 2:112898193-112898215 TGTCCAGTGGAGTTTTTTAGGGG + Intergenic
940089221 2:149897240-149897262 TGCCCAGGTGGCTTATCTGGTGG + Intergenic
943798633 2:192029965-192029987 TGCACAGTGGAGTTTTCCAGAGG - Intronic
945427460 2:209724025-209724047 TGCCCAGCTGACTTTTGTAGTGG - Intronic
946210788 2:218145464-218145486 ATCCCAGCGGGCATTTCTAGAGG + Intergenic
947180609 2:227407998-227408020 TGCCCAGTGGCCTTTACAGGGGG + Intergenic
948854920 2:240725573-240725595 TCCCCAGTGGGGTTTTCTCGAGG - Intronic
1169553295 20:6723498-6723520 TGGAAAGTGGGCATTTCTAGAGG - Intergenic
1170995806 20:21356965-21356987 TGCACAGTGGAGTTTTCCAGAGG + Intronic
1173932651 20:46833577-46833599 TGCGCAGTGGGGTTTTCCAGAGG - Intergenic
1174610468 20:51794001-51794023 TGCCCAGTAGGCTTTCTTAGGGG - Intronic
1175230606 20:57471194-57471216 TGCCCAGTGGGGGTTTGGAGTGG + Intergenic
1175993515 20:62801772-62801794 TGCCCAGTGGGCTTAACCTGTGG - Intergenic
1178821095 21:35976114-35976136 TGGCCAGGGGTCTTTTTTAGAGG + Intronic
1179165959 21:38935365-38935387 TCCCCACTGCCCTTTTCTAGTGG + Intergenic
1179309645 21:40184426-40184448 TGTCCTGTGGGCTTTTCTCCTGG + Intronic
1180722289 22:17918531-17918553 TGTACAGTGGCCTTTTCTAGAGG - Intronic
1181006914 22:20017826-20017848 TGCCCAGTGGGCTTTTCTAGGGG + Intronic
950477065 3:13221228-13221250 TGCCCAGAGGGATTTTCCTGAGG + Intergenic
950933820 3:16818449-16818471 TGTCCAGTGTGCTTTTCTCATGG - Intronic
951468305 3:23027014-23027036 TGTACAATGGACTTTTCTAGAGG - Intergenic
951918112 3:27823047-27823069 TGTGCAGTGGGATTTTCAAGAGG + Intergenic
952614868 3:35258640-35258662 TATCCAGTGGGATTATCTAGAGG + Intergenic
955958024 3:64310312-64310334 TGTTCAGTGGAGTTTTCTAGAGG + Intronic
956358222 3:68417438-68417460 TGCCATGTGAGCTTTTCAAGAGG - Intronic
956999326 3:74867056-74867078 GGCACAGTAGGCTTTTCTTGGGG + Intergenic
961328850 3:126127327-126127349 TTCCTAGTGGGCTTTCTTAGTGG + Intronic
961719941 3:128886857-128886879 TGCACAGTGGACTTTTCCAGAGG - Intronic
962853906 3:139327766-139327788 TGGCCAGTGGGCTCTTCTGTTGG - Intronic
963407150 3:144880522-144880544 TGACCAGTAGGGTTTTCTGGTGG - Intergenic
963733091 3:148991507-148991529 TGCCCCGTGCGCTCTTATAGCGG - Exonic
965347791 3:167573573-167573595 TGTACAGTGGAGTTTTCTAGAGG - Intronic
966339611 3:178911031-178911053 TGCCCTGTGTGCTTTTCAAGTGG + Intergenic
969457394 4:7308016-7308038 TGCCCACTGTCTTTTTCTAGAGG + Intronic
969477126 4:7428009-7428031 TGCTCTGTGGGCTCTTCTGGGGG + Intronic
977583550 4:98749792-98749814 TGTACAGTGGAGTTTTCTAGAGG + Intergenic
977683762 4:99824426-99824448 TGCCCAGTGGTTTTTACTGGTGG + Intronic
978419099 4:108511245-108511267 TACCCAGTGGGCCTTTCCACTGG - Intergenic
980793572 4:137651426-137651448 AGCTCAGTGGGCTTTTTTTGTGG - Intergenic
981278106 4:142925551-142925573 TGGCCAATGGGCTTTTCTTTAGG - Intergenic
990187289 5:53222238-53222260 TGCCCAGGAGGATCTTCTAGAGG - Intergenic
991270621 5:64775205-64775227 TGCCTAGTGGACTTTTCAACTGG + Intronic
998626320 5:143850298-143850320 TGCCATGTGGGCTTTTCAACAGG + Intergenic
999444241 5:151626514-151626536 TGCTCAGTGGCATTTTCCAGAGG - Intergenic
1000175670 5:158750272-158750294 TTCCCAGTGGGGTTTACTTGTGG + Intronic
1001547875 5:172581650-172581672 TGCCCAGTGGGCAGTGCTGGAGG - Intergenic
1001854022 5:174995190-174995212 TGCCCAGTAGGCTTTTGAAAAGG + Intergenic
1003977405 6:11357017-11357039 ACCCCAGTGGGCTTGGCTAGAGG - Intronic
1008007380 6:46425340-46425362 TGCACAGTGGAGTTTTCTAGAGG - Intronic
1011845251 6:91554921-91554943 TGCCCTGTGGGTTTTTAAAGTGG + Intergenic
1012976863 6:105789346-105789368 TGTACAGTGGACTTTTCTAGAGG + Intergenic
1015627449 6:135195076-135195098 TGCCCAGTAGGTATTCCTAGGGG + Intronic
1017391026 6:153939489-153939511 TCTCCAGTGGGCTTTTCTGGAGG + Intergenic
1017811927 6:157989891-157989913 GACCCTGTGGGCTTTTCTGGGGG + Intronic
1018589233 6:165399289-165399311 ATCCCAGTAGGCTTTTCTATAGG + Intronic
1018612941 6:165661799-165661821 CGCCCAGGGGGCTTCTCTGGAGG - Intronic
1022855838 7:34313256-34313278 TCCCCAGTGGCTTCTTCTAGTGG + Intergenic
1024060127 7:45691181-45691203 TGCTCATTGGGCATTGCTAGGGG - Intronic
1024212371 7:47217017-47217039 TCCCCAGAGGACTTTTCCAGAGG - Intergenic
1024576747 7:50770625-50770647 TGCACAGCGGAGTTTTCTAGAGG + Intronic
1026565756 7:71488534-71488556 TGCCCAGTGGGAATATCTGGGGG - Intronic
1029223638 7:99009260-99009282 TGCCCCGTGGTCCTTTCTATGGG + Intronic
1029972833 7:104805827-104805849 TTCCCTGAGGGCTGTTCTAGAGG - Intronic
1035004649 7:155646184-155646206 TGTACAGTGGAGTTTTCTAGAGG + Intronic
1036519533 8:9477532-9477554 TGCCCGCTGGCCTTTTGTAGAGG + Intergenic
1037049354 8:14350606-14350628 TTCAGAGTGGGCCTTTCTAGAGG - Intronic
1039288530 8:36068883-36068905 TGCCCATTGTCCTTTTCTAATGG + Intergenic
1040465940 8:47695098-47695120 TGTACAGTGGTGTTTTCTAGAGG - Intronic
1044738770 8:95304564-95304586 TGCCAAGAGGGCTCTTCAAGAGG - Intergenic
1049127767 8:140807893-140807915 TACCCAGTGGGCTTATCTACAGG + Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051731570 9:20148818-20148840 TGCCATGTGGGGTTTTCAAGGGG - Intergenic
1051822468 9:21183580-21183602 AGCACAGTGTGCATTTCTAGAGG + Intergenic
1051823711 9:21195641-21195663 AGCACAGTGCGCATTTCTAGAGG + Intergenic
1051825527 9:21214169-21214191 AGCACAGTGCGCATTTCTAGAGG + Intronic
1051827508 9:21236239-21236261 AGCACAGTGCGCATTTCTAGAGG + Intronic
1051830292 9:21268351-21268373 AGCACAGTGGGAATTTCTAGAGG + Intergenic
1053664582 9:40308615-40308637 TTCCAAGTGAGTTTTTCTAGAGG - Intronic
1054520032 9:66067669-66067691 TTCCAAGTGAGTTTTTCTAGAGG + Intergenic
1056125155 9:83529134-83529156 TGTACAGTGGAATTTTCTAGAGG - Intronic
1057444407 9:95103751-95103773 TGCGCAGTGGGCTCTTCTCCAGG - Intronic
1057482028 9:95452201-95452223 TGCCCAGTGGGCTATGCCACAGG + Intronic
1057713156 9:97465478-97465500 GGCCCACTGGCCTTTTCAAGAGG - Intronic
1058924078 9:109644324-109644346 TTCAAAGTGGGCTTTTCTACCGG - Intronic
1060030924 9:120214121-120214143 TTCCCAGTGGGGTTTTCTCCTGG + Intergenic
1060150383 9:121284630-121284652 GGCGCAGTGGGCTCTTCCAGCGG - Intronic
1062627049 9:137448081-137448103 TGCCCTGTGGGGTGGTCTAGTGG + Exonic
1186143960 X:6606478-6606500 TGTGCAGTGGGCTTTTCACGTGG - Intergenic
1187086735 X:16049430-16049452 TGGCAAGTCCGCTTTTCTAGAGG - Intergenic
1191979294 X:66908303-66908325 TGCCATGTGGGCTTCTCTATAGG + Intergenic
1192036622 X:67569510-67569532 TACCCTGTGTGCTTTGCTAGTGG + Intronic
1198217387 X:134568427-134568449 AGGCCAGTGCGTTTTTCTAGCGG - Intronic
1198343947 X:135741321-135741343 GGGCCAGGGGGCTTTTCTTGGGG + Intergenic
1198346825 X:135767704-135767726 GGGCCAGGGGGCTTTTCTTGGGG - Intronic
1198348732 X:135784988-135785010 GGGCCAGGGGGCTTTTCTTGGGG - Intergenic
1198350637 X:135802262-135802284 GGGCCAGGGGGCTTTTCTTGGGG - Intronic
1198352544 X:135819525-135819547 GGGCCAGGGGGCTTTTCTTGGGG - Intronic
1198354453 X:135836793-135836815 GGGCCAGGGGGCTTTTCTTGGGG - Intronic
1198356363 X:135854051-135854073 GGGCCAGGGGGCTTTTCTTGGGG - Intronic
1198358276 X:135871325-135871347 GGGCCAGGGGGCTTTTCTTGGGG - Intergenic
1198360190 X:135888599-135888621 GGGCCAGGGGGCTTTTCTTGGGG - Intronic
1198718015 X:139583082-139583104 TACACAGTGGAGTTTTCTAGAGG + Intronic
1199410724 X:147519327-147519349 TCACCAGTGTGTTTTTCTAGTGG - Intergenic
1199853325 X:151740502-151740524 TGCCCAGAGGGCATGTCAAGGGG - Intronic
1200122331 X:153797110-153797132 TGCCCAGTGGGCTGCCCAAGGGG - Intronic