ID: 1181010127

View in Genome Browser
Species Human (GRCh38)
Location 22:20035392-20035414
Sequence CAGTGCTCACAGCTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181010127_1181010136 30 Left 1181010127 22:20035392-20035414 CCATGTCCCAGCTGTGAGCACTG 0: 1
1: 0
2: 2
3: 45
4: 344
Right 1181010136 22:20035445-20035467 TTGCACATGTGCACATTTCAGGG 0: 1
1: 0
2: 1
3: 15
4: 226
1181010127_1181010135 29 Left 1181010127 22:20035392-20035414 CCATGTCCCAGCTGTGAGCACTG 0: 1
1: 0
2: 2
3: 45
4: 344
Right 1181010135 22:20035444-20035466 ATTGCACATGTGCACATTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181010127 Original CRISPR CAGTGCTCACAGCTGGGACA TGG (reversed) Intronic
900479021 1:2889413-2889435 CAGTCCTCAGGGCAGGGACAGGG - Intergenic
900618260 1:3575219-3575241 CAGCGCACACAGGTGGGACCCGG + Intronic
900630659 1:3633460-3633482 AAGAGCCCACAGCTGGGACTGGG - Exonic
901031404 1:6309064-6309086 CAGTGTGCACACCTGGGTCAAGG - Intronic
902195416 1:14794510-14794532 CAGTTCTCACTGCGGGGCCAGGG + Intronic
902615563 1:17621736-17621758 CAGTGGTCCCAGGTGGGACCTGG + Intronic
903053553 1:20619319-20619341 CAGTGCTCTCATCTGTGAAAAGG - Intergenic
904498842 1:30902571-30902593 CCCTGCTCCCTGCTGGGACAGGG + Intronic
904610614 1:31724299-31724321 GAGTGCTGACTGCTGGGCCAGGG + Intergenic
905615950 1:39398889-39398911 CAGTACTCCCAGCTGGTGCAAGG - Intronic
905862220 1:41359492-41359514 CACAGCTCAGAGCTGGGCCAGGG + Intergenic
906034065 1:42740090-42740112 CAGGACTCAGAGCTGGGCCAGGG + Exonic
907269263 1:53281075-53281097 AAGGGCACACAGCTGGGAAATGG - Intronic
907411619 1:54287454-54287476 ATGTGCTCAAAGCTGGGAAATGG + Intronic
907947910 1:59152607-59152629 CACAGCTCACAGCTGGCAAATGG - Intergenic
907969441 1:59366467-59366489 CAGGGCTCAGAGCGGGGAAAGGG - Intronic
908509157 1:64837409-64837431 CAGTGTTCCCGGCTGAGACATGG + Intronic
910625658 1:89303597-89303619 CAGTGCTAGCAGGTGGGAGATGG + Intergenic
911026892 1:93446229-93446251 CACTGCGCCCAGCTGGGAAATGG - Intergenic
912453807 1:109784576-109784598 CAGTCCTGACATTTGGGACATGG + Intergenic
913483773 1:119315463-119315485 TAGTGATCACATCTGTGACACGG - Intergenic
914396567 1:147275178-147275200 CACTTCTCACCGCTGGAACAAGG + Intronic
915571563 1:156747696-156747718 CAGTGCCCACACCTGAGCCAGGG + Intronic
917716825 1:177746834-177746856 CAGAGATCACAACTGGGTCAGGG + Intergenic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
918303865 1:183228370-183228392 CAGAGCTCACAGCGGGCACCTGG - Exonic
919423275 1:197398560-197398582 CATTGAACACAGCTAGGACAGGG + Intronic
919518236 1:198554199-198554221 CTGTGATCCCAGCAGGGACAAGG + Intergenic
919980825 1:202642247-202642269 CAGTGCTCACTTCCGGGGCAGGG - Intronic
920181942 1:204137434-204137456 CAGTGCTCCTAGCTGGGATGGGG - Intronic
920444225 1:206003333-206003355 CAGTGGTCTCAGCAGGGCCAGGG + Intronic
921294680 1:213690721-213690743 CAGTTTTCTCAGCTGGGAAATGG + Intergenic
921301902 1:213759524-213759546 CAGTCTTCACATCTGTGACATGG - Intergenic
921385781 1:214568436-214568458 CAGGACTCACAGCTAGGCCATGG + Intergenic
922050563 1:221986329-221986351 CACTGCTCACAGCAGAGGCAAGG - Intergenic
922792431 1:228317684-228317706 CAGGGCCCACAGCTGCCACACGG - Exonic
923916704 1:238514527-238514549 CAGGGGTCACAGCTGGTAAAAGG - Intergenic
1067088832 10:43256364-43256386 ATGTGCTCAGAGATGGGACAAGG + Intronic
1067433033 10:46256454-46256476 AGGTGCTCACAGCTGTGGCATGG + Intergenic
1067440230 10:46304970-46304992 AGGTGCTCACAGCTGTGGCATGG - Intronic
1068120806 10:52780490-52780512 CAGAGCTCACATCTTGGAAAGGG - Intergenic
1070819273 10:79345568-79345590 CAGAGTTCACAGCTGGGAAAGGG + Intergenic
1071465448 10:85935498-85935520 CATGCCTCAGAGCTGGGACATGG + Intronic
1071992974 10:91118188-91118210 CAGAGCTCACAGCTAGGAAGTGG + Intergenic
1072888995 10:99304723-99304745 ATGTGCTCACTCCTGGGACAAGG + Intergenic
1073111327 10:101064634-101064656 CAGTGCTCACACCTGGTAAGGGG + Exonic
1073459709 10:103659626-103659648 GAGGCCTCACAGCAGGGACATGG + Intronic
1074077502 10:110142370-110142392 CAGTGCTCAGAGCCAAGACAAGG + Intergenic
1074198126 10:111207280-111207302 CAGTGCTAGCAGCTGGGTGAAGG - Intergenic
1074531435 10:114301348-114301370 CAGAGCTCACAGCTGCGGTAAGG - Exonic
1075916744 10:126174411-126174433 CAAAGCTCACAGCTGGGTCAGGG - Intronic
1076634115 10:131871786-131871808 CAGGGCTCACAGCCGGGAGCAGG + Intergenic
1076652007 10:131996496-131996518 CTGTGCTCACTGCTGGGAACTGG + Intergenic
1077195562 11:1278333-1278355 CAGTGATCCTAGCTGGGAGATGG - Intronic
1077252001 11:1564843-1564865 CCCTGTTCAGAGCTGGGACATGG - Intronic
1077621172 11:3725484-3725506 AAGTGCTCAGAGCTGGGAGGAGG - Intronic
1077932782 11:6751623-6751645 ATGTGCTCACTCCTGGGACAAGG - Intergenic
1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG + Intergenic
1079006216 11:16793228-16793250 GAATGCTGCCAGCTGGGACAGGG - Intronic
1079296949 11:19242120-19242142 GAGTTCTCACCGCTGGGCCAAGG - Intergenic
1079444530 11:20546866-20546888 CAGAGCTGACAGCTTGGGCAAGG + Intergenic
1080233771 11:30046131-30046153 CTGTGCTGACAGTTGGCACAAGG + Intergenic
1080787561 11:35489572-35489594 CAGGGCTCAGAGCTTAGACATGG - Intronic
1084270206 11:68025322-68025344 CTCTGATCACAGCTGGGTCAGGG - Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085311182 11:75517834-75517856 CAGTTCTCCCAGGTGGGACAGGG + Intronic
1085455517 11:76663330-76663352 CAGTGTTCACATCTGGGAAGTGG - Intronic
1086377342 11:86214795-86214817 CAGTGCTCACTGTTGGAGCAGGG + Intergenic
1086600811 11:88630962-88630984 CTGTCCCCACAGCTGTGACATGG - Intronic
1088365783 11:109038583-109038605 CACTGCTCACAACTGGCTCAGGG - Intergenic
1089340022 11:117750930-117750952 CAGACTTCACAGCTGGGGCAGGG - Intronic
1089579183 11:119470863-119470885 CTGTGCCCACAGCTGGGCCGGGG + Intergenic
1089649357 11:119902246-119902268 TAGAGCTAACAGCTGTGACATGG - Intergenic
1090334987 11:125956041-125956063 CAGTCTTCACAACTGGTACAAGG + Exonic
1090895168 11:130965340-130965362 CTGTGCTCACACCTGGGTGATGG - Intergenic
1091218283 11:133916812-133916834 GAGGAGTCACAGCTGGGACAGGG + Intronic
1092670172 12:10853450-10853472 CAGTGCTCACAGGTGTAGCAGGG - Intronic
1096747788 12:53739592-53739614 CTGCGCTCAGAGCTGGGACTCGG - Intergenic
1101044389 12:100789625-100789647 CAGCGCACTGAGCTGGGACATGG + Intronic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1102633356 12:114301176-114301198 CAGTGCTCACAGCTGGGCAGAGG + Intergenic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103898517 12:124290875-124290897 CAGATCACACAGCCGGGACATGG + Intronic
1104551815 12:129764034-129764056 CAATACTCAAAGCTGGGGCATGG - Intronic
1104559964 12:129834545-129834567 CAGTGCTAGCAGCTGGTGCATGG - Intronic
1104658519 12:130592030-130592052 GAGAGCTCAAAGCTGGGTCAAGG + Intronic
1105783017 13:23720874-23720896 CACCGCACACAGCTGGGACTGGG + Intergenic
1105944267 13:25176285-25176307 CAGTGCTGTCAGCTGCCACATGG - Intergenic
1106227167 13:27794163-27794185 CAGTGTTCACAGCTTGGAGTTGG - Exonic
1107882304 13:44843310-44843332 CAGTGTTCTGAGCCGGGACATGG - Intergenic
1108071921 13:46636969-46636991 AAGTGTTCACAGCTGGGCCTCGG - Intronic
1108303642 13:49107808-49107830 CAGTGCTGACAGCTGAGTTAAGG + Intronic
1109722457 13:66293036-66293058 CAGTGTTCTCATCTGTGACAGGG + Intergenic
1111909657 13:94296570-94296592 AAGTGCTGAGAGCTGGGATAAGG - Intronic
1113526046 13:110977701-110977723 GAGTGCGCACAGCTGGGTTAAGG - Intergenic
1113599075 13:111555385-111555407 CAGTGCCCTCTGCTGAGACAGGG - Intergenic
1113707902 13:112446027-112446049 CAGTGGTCAGAGGTGGGGCAGGG + Intergenic
1114566976 14:23639874-23639896 CAGTGAGCAGATCTGGGACAAGG + Exonic
1118612976 14:67555768-67555790 CCGTGTTCACAGTAGGGACATGG + Intronic
1118822904 14:69356534-69356556 AAGAGCTCACAGCTGGCAAATGG - Exonic
1119687555 14:76644804-76644826 CAGCCCTCACAGCTGAGGCAGGG + Intergenic
1120656115 14:87191875-87191897 AAGTGCACACAGCTGGCACATGG + Intergenic
1120881939 14:89420316-89420338 TACTGCTAACAGCTGAGACAAGG + Intronic
1122531462 14:102430521-102430543 CAGGGCTAGCTGCTGGGACATGG - Intronic
1122820577 14:104342844-104342866 CAGGGCTCAGATCTGTGACATGG - Intergenic
1123039823 14:105485948-105485970 CAGCGCCCCCAGCGGGGACAGGG + Intergenic
1123775886 15:23579474-23579496 CAGTGCTCTCAGCTGCTACAAGG - Intronic
1124496524 15:30190991-30191013 CAGTGCTCACTTCCGGGGCAGGG - Intergenic
1124512570 15:30339675-30339697 CGGTGCCCACAGCTGGGCCTTGG - Intergenic
1124593952 15:31078362-31078384 TAGTCCGCACAGCTGGGACTAGG - Intronic
1124730345 15:32191075-32191097 CGGTGCCCACAGCTGGGCCTTGG + Intergenic
1124747051 15:32347657-32347679 CAGTGCTCACTTCCGGGGCAGGG + Intergenic
1126189186 15:45861967-45861989 CCTTGTTCAGAGCTGGGACATGG + Intergenic
1127796347 15:62441712-62441734 CAGTCCCCACTGCTGGGAAAGGG + Intronic
1128902592 15:71438101-71438123 CACTGCACAGAGCTGGGACCAGG - Intronic
1129238303 15:74236856-74236878 CAGTTTTCACAGCTGTGAAATGG + Intronic
1129753718 15:78083422-78083444 CAGAGCACACAGCTGCCACAGGG + Intronic
1130085338 15:80773924-80773946 CAGTGCTCACAGCTGGAGGTAGG + Intergenic
1131066163 15:89436128-89436150 GAGTGCTCACAGCAGGCACGAGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131679971 15:94710915-94710937 CAGTTTTCTCAGCTGGGAAATGG + Intergenic
1132745680 16:1435260-1435282 GAGTGCTTACAGCTTGGGCAGGG + Intronic
1132789964 16:1680224-1680246 AAATGCACACAACTGGGACAGGG - Intronic
1132898245 16:2238904-2238926 CTGTGAGCACAGCTGGGACAGGG + Intergenic
1134914635 16:18059630-18059652 CACTGCTGACAGTGGGGACAAGG - Intergenic
1135051280 16:19195032-19195054 AAGTTCACACAGCTGGGAAATGG - Intronic
1135994912 16:27240495-27240517 CAGTGCTCAGGGCTGGGCCAAGG - Intronic
1136718348 16:32302068-32302090 CAGGGCTAGCATCTGGGACAGGG + Intergenic
1136722758 16:32337972-32337994 CAATGCTCAGACCAGGGACAGGG + Intergenic
1136836722 16:33508338-33508360 CAGGGCTAGCATCTGGGACAGGG + Intergenic
1136841080 16:33543971-33543993 CAATGCTCAGACCAGGGACAGGG + Intergenic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1138416693 16:56875731-56875753 CAGTGCACACAGCAGGGAAGAGG + Intronic
1138563950 16:57818978-57819000 CACAGCTCACAGCTGAGCCACGG + Intronic
1139548899 16:67662670-67662692 CACTCCACACTGCTGGGACATGG + Exonic
1139631402 16:68234088-68234110 CAGTTCTCACAGCTGGTGAACGG - Exonic
1141268894 16:82521360-82521382 CGGGGCTGACAGCTGGGGCATGG - Intergenic
1141690645 16:85594351-85594373 CAGGGCTCACAGATGGGGCCTGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142325349 16:89411282-89411304 CAGTGCTGGCTGCTGGCACAGGG - Intronic
1142376308 16:89708746-89708768 CAGTGCAGCCAGCTGGCACAAGG + Intronic
1203003673 16_KI270728v1_random:179792-179814 CAATGCTCAGACCAGGGACAGGG - Intergenic
1203008080 16_KI270728v1_random:215697-215719 CAGGGCTAGCATCTGGGACAGGG - Intergenic
1203135281 16_KI270728v1_random:1716199-1716221 CAATGCTCAGACCAGGGACAGGG - Intergenic
1203146902 16_KI270728v1_random:1808617-1808639 CAGGGCTAGCATCTGGGACAGGG + Intergenic
1203151245 16_KI270728v1_random:1844268-1844290 CAATGCTCAGACCAGGGACAGGG + Intergenic
1142864227 17:2780529-2780551 CATTGCTCAGAGATGGGAGAGGG - Intronic
1142968261 17:3594433-3594455 CAGAGCACACAACTGGGCCATGG + Intronic
1143153960 17:4823887-4823909 CAGTGGTCCCCGCTGGGAAATGG + Intergenic
1143993351 17:10986000-10986022 CAGTGCTATCAGCAGGGATAAGG + Intergenic
1144095292 17:11894782-11894804 CAGGGCTTAAGGCTGGGACATGG + Intronic
1144232749 17:13225311-13225333 CAGAGCTCACAGGTGCAACAGGG + Intergenic
1144328960 17:14207199-14207221 CAGTGCTCTCAGCTGGGAGGGGG - Exonic
1145242077 17:21245901-21245923 CAGTGGCCACAGCTGGGCCTTGG - Intronic
1146471710 17:33130085-33130107 CAGAGCCCACAGATGAGACACGG - Intronic
1148123819 17:45226815-45226837 GGGTCCCCACAGCTGGGACAAGG - Intronic
1150002747 17:61451922-61451944 CAGCGCGCACAGCTGGGAGCAGG + Intergenic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1150852269 17:68714971-68714993 CAGTAGTCACAGGGGGGACACGG - Intergenic
1151146662 17:72047472-72047494 GAGTGCACACAGCAGGGAGAGGG + Intergenic
1151436254 17:74099634-74099656 CAGAGATCACAGCTGGGAGATGG + Intergenic
1151930688 17:77229849-77229871 ATGTGCCCACAGCTGGGACAAGG + Intergenic
1152400639 17:80064534-80064556 CAGTGTCCCCAGCTGTGACATGG - Intronic
1152844410 17:82591055-82591077 CAGTGCTGACAGATGGGAGGTGG + Intronic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1156295047 18:35781877-35781899 CAGGGCACAGAGCTGGCACATGG - Intergenic
1156395168 18:36692824-36692846 CGGAGCTCACAGCTGTGAAATGG - Intronic
1157401718 18:47394213-47394235 CACTCCACACACCTGGGACAGGG - Intergenic
1157516396 18:48314770-48314792 GACTGCTGACAGCTGGGAGAAGG + Intronic
1157535822 18:48456588-48456610 CAGGCCTCAGAGCTTGGACAGGG + Intergenic
1160099312 18:75905248-75905270 CAGAGCTCTCAGCTGTGACAAGG + Intergenic
1160307112 18:77750216-77750238 CAGTGGTTACAGCTGGAAAAAGG + Intergenic
1160337285 18:78053826-78053848 CAGTGCTCCAAGCAGGGAGAGGG + Intergenic
1160495059 18:79368475-79368497 GAGTGCTCGCAACTGGGCCAGGG - Intronic
1160675753 19:390443-390465 CAGTGTTCCCATCTGTGACAGGG - Intergenic
1161043200 19:2120957-2120979 CAGCGCAGACATCTGGGACACGG + Exonic
1161447692 19:4327595-4327617 CACTGCTCCCAGCGGGGACCAGG + Intronic
1161857701 19:6775094-6775116 CACTGTCCTCAGCTGGGACAGGG + Intronic
1162086806 19:8254358-8254380 CAGAGAGCACAGCTGGCACATGG - Intronic
1162127841 19:8508878-8508900 CACTCCTCAGAGCTGGGACATGG + Intergenic
1165068153 19:33240871-33240893 CAGTGCCTACAACTGGGAAATGG + Intergenic
1165223669 19:34338707-34338729 AAGGCCTCACAGCTGGGACAAGG + Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1166060153 19:40320916-40320938 CAGGGCTTGCAGCAGGGACATGG + Exonic
1166261078 19:41641356-41641378 CATTGCACGCTGCTGGGACAAGG - Intronic
1166434700 19:42757715-42757737 CAGTGAACACAGCTGGGATTTGG - Intronic
1166657963 19:44626160-44626182 CAAGGTTCAGAGCTGGGACATGG + Intronic
1166923510 19:46249396-46249418 CAGGCCTCACTCCTGGGACATGG + Intergenic
1166942159 19:46373759-46373781 CAGGGCTCACGGCTGGAACAAGG + Intronic
1167096568 19:47377754-47377776 GACTTCTCAGAGCTGGGACAGGG + Intronic
1167576665 19:50320956-50320978 CAGGGGGCACAGCTGGGAGAGGG + Intronic
925297775 2:2789610-2789632 TGGTGCTCACAGGTGGGAAAGGG + Intergenic
925383651 2:3446661-3446683 CAGTGGGCACTGCGGGGACATGG + Intronic
925842270 2:8003640-8003662 AAGTGCACAGAGCTGGGATATGG + Intergenic
925853144 2:8103746-8103768 CAGTGCTCACAGCAAAGGCAGGG - Intergenic
925971922 2:9112089-9112111 CAGTCCTCACAGCTGCGTGATGG - Intergenic
926026544 2:9550173-9550195 CAGTGCTCTCTGCTAGGCCAGGG + Intronic
926104804 2:10143429-10143451 CAGGGCACTCAGCTGGAACAAGG - Intronic
927477586 2:23425807-23425829 CAGTGCTCACAAATGGTACAAGG - Intronic
927970726 2:27304919-27304941 CAGCACTCAGAGCTGGGACCTGG - Intronic
928847609 2:35696643-35696665 CTTTGCTCTCAGCTGTGACAAGG + Intergenic
929087213 2:38180528-38180550 CAGGCCTCACAGCTGGCATATGG + Intergenic
931931570 2:67142822-67142844 AAATACTCACAGGTGGGACAAGG + Intergenic
933460492 2:82577586-82577608 AAGTTCTCACAGCTAGGAAATGG - Intergenic
933941592 2:87249570-87249592 CCGTGCTCCCAGCTGCAACATGG - Intergenic
933955057 2:87356883-87356905 CAGTGCTCAGGCCAGGGACAGGG - Intergenic
934239248 2:90253097-90253119 CAGTGCTCAGGCCAGGGACAGGG - Intergenic
934273938 2:91563601-91563623 CAGTGCTCAGGCCAGGGACAGGG + Intergenic
935091087 2:99895672-99895694 CAGAGCACACAGCAGGGACTCGG + Intronic
935980039 2:108617829-108617851 CAGTCCTCTCAGCTGGGATGGGG + Intronic
936399356 2:112153951-112153973 CAGTGCTGAGAGCTGGGCGAGGG - Intronic
936568647 2:113598239-113598261 CAGTGCCCAGTGCTGGGTCAGGG + Intergenic
936935532 2:117835693-117835715 GAGTGTCCACAGCTGGGAAAGGG + Intergenic
937543578 2:122988830-122988852 CTGGGCTCACGTCTGGGACAGGG - Intergenic
937714583 2:125016857-125016879 AATTGCTCACAGCTGGCACCAGG + Intergenic
937873865 2:126805387-126805409 AGGTGCTTACAGCTGGGACCAGG - Intergenic
944692447 2:202170151-202170173 CAGGGCTCACAAATGGCACAGGG - Intronic
945444302 2:209917780-209917802 CACTGCACACAGCAGGAACATGG - Exonic
946413221 2:219526053-219526075 CAGGGCTCAGAGCTGTGGCAGGG - Intronic
946596090 2:221307571-221307593 TAGTGATAACAGCTGGGCCAAGG - Intergenic
948182366 2:235992323-235992345 CAGTGCTCTCAGCTGTAAAATGG + Intronic
949045343 2:241870242-241870264 CAGTGCTGACAGGTGGGCCCTGG + Intronic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1169429302 20:5522227-5522249 AATTGGTCACAGCTGGCACAAGG + Intergenic
1172222671 20:33284496-33284518 CAGAGCTCACAGCTTGGTCAGGG + Intronic
1172694536 20:36813003-36813025 CAGTGCCCCCAGCTGGGGCTGGG - Intronic
1172838422 20:37887664-37887686 CAGTGCTCACAGCTCAGTCAGGG + Intergenic
1173438351 20:43053300-43053322 CAGTGCTCATATCTGGATCATGG + Intronic
1173562973 20:44019512-44019534 CAAAGCTCTCAGCTGAGACAGGG + Intronic
1173924500 20:46770779-46770801 CAGTGCTTCCAGGTGGGACCCGG + Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1175418042 20:58814682-58814704 CAAGGGTCACAGCTGGGACATGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176122527 20:63460499-63460521 CAGTGCCCTCAGCTGGTCCACGG + Intronic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1176208470 20:63904420-63904442 CAGTGCTCACACCAGGGAGAAGG - Intronic
1176842782 21:13853779-13853801 CAGTGCTAATAGCTAAGACAAGG - Intergenic
1176845468 21:13873126-13873148 CAGTGCTAATAGCTAAGACAAGG - Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179183583 21:39065416-39065438 CACTGCTCACAACTGGAAGATGG + Intergenic
1179909531 21:44440691-44440713 CTGTGCTCAGAGCTGGGTCAGGG + Intronic
1180876951 22:19178987-19179009 CACTGCTCGGAGCTGGGCCACGG - Intergenic
1181010127 22:20035392-20035414 CAGTGCTCACAGCTGGGACATGG - Intronic
1181316144 22:21972012-21972034 CAGTGCTCCCATCCAGGACAGGG + Intronic
1181577331 22:23803304-23803326 CATGGATCACAGCTGGGTCATGG - Exonic
1183932083 22:41240967-41240989 CAGGCCTGGCAGCTGGGACAGGG + Intergenic
1184406601 22:44304131-44304153 CAGAGCTCACAGCCTGGTCAGGG + Intronic
1185031995 22:48449027-48449049 CTGACCTCACAGCTGGGACGTGG - Intergenic
949231145 3:1752376-1752398 AACTGCTCACAGCTGGCACCAGG + Intergenic
949853898 3:8442469-8442491 CAGTGCTCCCACCTGTGAAATGG - Intergenic
950038162 3:9902213-9902235 CAGAGCTCACAGCTGAGCCCTGG - Intergenic
950040110 3:9914848-9914870 CAGTGCTGAGAGCTCAGACAGGG - Intronic
950539495 3:13601779-13601801 CAGTGCTGACTGCTGTGAGAGGG + Intronic
950662514 3:14475318-14475340 CACTGCACCCAGCTGGGACATGG + Intronic
950689143 3:14641811-14641833 CAGTGGTCAGGGCAGGGACATGG - Intergenic
950749529 3:15117797-15117819 AAGTTCTCACAGCTGGGATGTGG - Intergenic
952532585 3:34277454-34277476 TGGAGCTCAAAGCTGGGACATGG + Intergenic
953023445 3:39130555-39130577 CACTCCTCCCAGCTGGCACAGGG - Intronic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
954219377 3:49143696-49143718 CAGTGGTCACAGCTGAGGCCTGG + Intergenic
956253890 3:67263573-67263595 CAGTGCTACCAGCAGGAACATGG - Intergenic
959029748 3:101284701-101284723 CTGTGTGCACAGCTAGGACAAGG - Intronic
961303279 3:125936089-125936111 CGGTGGGCAGAGCTGGGACATGG + Intronic
961314660 3:126026307-126026329 GGGGGCTCACAGCTGGGGCATGG + Intronic
961670553 3:128525415-128525437 CACTGTTCACAACTGGGAGAAGG - Intergenic
964742795 3:159984957-159984979 CAGGGTTAACAGCTGGGTCATGG + Intergenic
966315985 3:178645739-178645761 CAGTGCTCACAGCAGGCAGTTGG + Intronic
967759171 3:193204555-193204577 CAGTGCTCACAGCTACACCAGGG - Intergenic
967826880 3:193884075-193884097 CAGTGGTCACAGATGGCTCACGG - Intergenic
967897229 3:194407541-194407563 CCGTGCTCTCAGCGGGGCCAGGG - Intronic
967928693 3:194674054-194674076 CAGTGCTCACAGATGAGCAAAGG + Intergenic
968946017 4:3664702-3664724 CCGTGCTCAGAGCTGGGACATGG + Intergenic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
971117437 4:23664528-23664550 CAGTGCTCACAGCTTGCAGCAGG - Intergenic
973792466 4:54391134-54391156 CAGTGTTCACAGCAGGGCCATGG - Intergenic
977475709 4:97506334-97506356 CAAGGCTTACAGCTGGGACATGG + Intronic
981316130 4:143341483-143341505 CAATGCTGACAGCTGGGCTATGG - Intronic
984061412 4:174992476-174992498 CAGTGTTCACAGCTTCAACAGGG + Intergenic
984896629 4:184547317-184547339 AGGTGCACACAGCTGGGACCTGG - Intergenic
987854843 5:23407432-23407454 CCTTTCTCCCAGCTGGGACAAGG + Intergenic
988816641 5:34840689-34840711 CATTGCTAACAGTTGGGATACGG - Exonic
994881188 5:105498507-105498529 CTGTGCTCTCTGCTGTGACAGGG + Intergenic
994881381 5:105501573-105501595 CTGTGCTCCCTGCTGTGACAGGG - Intergenic
995490857 5:112690372-112690394 CAGTGCCCACAGCCTGAACATGG - Intergenic
995796693 5:115948715-115948737 CAGTTCTCACAGCTGGGGAGTGG - Intergenic
997424417 5:133793521-133793543 AAGGTCTCACAGCTGGAACATGG + Intergenic
998132087 5:139656303-139656325 CAGTGATCACAGCAGAGCCAAGG - Intronic
998448598 5:142217330-142217352 CTGTGCTCAGAACTGGGACGTGG - Intergenic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
999530145 5:152454144-152454166 CAGTTTTCACAGCTGGTAAAGGG + Intergenic
999544970 5:152617637-152617659 AATTGCTCAGAGCTGGGGCAAGG - Intergenic
999700455 5:154223346-154223368 CAGTTCGTACAGCTAGGACATGG + Intronic
1001341370 5:170849317-170849339 CATTGCTCAGAGCTGGGAAATGG - Intergenic
1002321081 5:178376417-178376439 CAGGGACCACAGCTGGGACAGGG + Intronic
1002419466 5:179138089-179138111 CAGGTCTTACAGCTAGGACATGG - Intronic
1003644645 6:7904712-7904734 CAGTGTCCACACCTGGAACAAGG + Exonic
1004760734 6:18663233-18663255 CAGTGCACATGGCTGGGAAATGG - Intergenic
1005200434 6:23338441-23338463 CAATGCTCAGAGGTGGAACAGGG - Intergenic
1005405755 6:25486087-25486109 CAGTGTTTACAGCTGGAAAAAGG - Intronic
1006112608 6:31757637-31757659 CTGTGAGCACATCTGGGACAGGG + Intronic
1006154617 6:32007530-32007552 CAGTGCTCAGAGCTGAGTGAGGG - Intergenic
1006160929 6:32040265-32040287 CAGTGCTCAGAGCTGAGTGAGGG - Intronic
1006374863 6:33666222-33666244 CAGGGCTCACAGCTAGGAAGCGG + Intronic
1006877954 6:37314967-37314989 GAGGGCTAACAGCTGGGCCAGGG - Intronic
1007075398 6:39063007-39063029 CACTTCCCACAGCTGGCACAGGG - Intronic
1007778500 6:44237632-44237654 CCGGGATCACAGCTGGTACAGGG - Intergenic
1008571334 6:52819998-52820020 CAGTGCTCAGAGCAGGGAGTGGG - Intergenic
1008605596 6:53136684-53136706 CACTGCACCCAGCTGGGACTTGG - Intronic
1009552021 6:65109692-65109714 CAGTGCTCACAGTTGTGACAGGG - Intronic
1010212783 6:73375258-73375280 CTGTTCTCTCAGCTGGGAAAAGG - Intronic
1015548701 6:134389427-134389449 CAGTGCTCACAGCAAGGTCTTGG - Intergenic
1016996955 6:149967465-149967487 CAGTTCTCAAAGCTGGGCAAAGG + Intronic
1017001855 6:150002787-150002809 CAGTTCTCAAAGCTGGGCAAAGG - Intergenic
1017011571 6:150067206-150067228 CAGTTCTCAAAGCTGGGCGAGGG - Intronic
1017021610 6:150143893-150143915 CAGCGCTCACTGCTGGGATCCGG + Intronic
1018174707 6:161168473-161168495 CTGTGGTCACAGCTGTGATAGGG - Intronic
1018295976 6:162344542-162344564 CTGCCCTCACAGCTGGGTCAGGG + Intronic
1018389690 6:163332535-163332557 CAGGGATCACAGCTGAGACCAGG - Intergenic
1018673879 6:166202379-166202401 CACGCCTCACAGCTGGGACTGGG - Intergenic
1018673885 6:166202405-166202427 CACGCCTCACAGCTGGGACTGGG - Intergenic
1018801162 6:167223324-167223346 CAGGGCTCACAGATGGTAAAAGG - Intergenic
1019074742 6:169378294-169378316 AAGTGCACACGGCTGGGCCATGG - Intergenic
1019431354 7:1001274-1001296 CAGCGCTCACAACAGGCACAGGG - Intronic
1019596902 7:1862266-1862288 CAGTCCTCACAGCTGGGGCCAGG - Intronic
1021172218 7:17412969-17412991 CAGTGCCCAAGGGTGGGACAAGG - Intergenic
1022364225 7:29695342-29695364 CAGGCCTGACAGCAGGGACACGG + Intergenic
1022567044 7:31413838-31413860 CAGTGTTCACAGCTGTTCCATGG + Intergenic
1022697139 7:32718390-32718412 CAGGCCTGACAGCAGGGACACGG - Intergenic
1022962696 7:35444785-35444807 CATTGCCCACAGCTGGTCCAAGG - Intergenic
1023228544 7:37998857-37998879 TAGTGCTTACTGCTGGGACTAGG + Intronic
1026585030 7:71649058-71649080 CAGTGGTGACAGCTGGGTAATGG - Intronic
1027834225 7:83219645-83219667 CAGTTCTCACATCCAGGACATGG - Intergenic
1027940511 7:84672997-84673019 CAGTGCTCACAGCTTGGGCTGGG + Intergenic
1028611588 7:92718072-92718094 CAGTGCACAGAGCTGGGAACAGG - Intronic
1029161971 7:98559003-98559025 CAGGGGTAACAGCTGGGACTGGG - Intergenic
1030199787 7:106891059-106891081 CAGAGCTCACAGTTGGGATAGGG - Intronic
1030673516 7:112362622-112362644 GAGTGCTGTCAGCTGGAACAAGG - Intergenic
1030927118 7:115472107-115472129 GAGTGCCCACATCTGGGCCATGG - Intergenic
1031680554 7:124668236-124668258 AAGTTCACACAGCTGGTACATGG - Intergenic
1034225433 7:149477505-149477527 CAGGGATCACAGGAGGGACAGGG - Intronic
1034450623 7:151135345-151135367 AAGCGCTGACTGCTGGGACAGGG - Intronic
1035072196 7:156153815-156153837 TGGTGCTCACAGCTGGGCCCTGG - Intergenic
1035768677 8:2129281-2129303 CAGGGCGCACAGCTGGGACCAGG + Intronic
1036653808 8:10662715-10662737 CAGTGGTCACATCTGGGTCAGGG + Intronic
1036757631 8:11481765-11481787 CATTGCTATCAGCTGGGACGAGG - Intergenic
1038680020 8:29658208-29658230 CAGTGCAAACAGCTGGGAATTGG + Intergenic
1039389245 8:37163804-37163826 CATTGGTCAGAGCTGGGACATGG - Intergenic
1039443350 8:37611051-37611073 AAGTGCTCAGAGCTGGGAAAAGG - Intergenic
1040582404 8:48708295-48708317 CAGTGCTCCCGGCTGGGCCCAGG - Intergenic
1040776250 8:51046302-51046324 GCGTGATCACAGGTGGGACAAGG + Intergenic
1041388780 8:57330821-57330843 CACTGCTCACAGCTGGCCCATGG + Intergenic
1042203069 8:66300609-66300631 CATCGATCACTGCTGGGACATGG + Intergenic
1042667345 8:71221414-71221436 CAGTTCTCACATCTGTGACTTGG - Intronic
1042982402 8:74545070-74545092 CAGTTCTAGCAGCTGGGAGAAGG - Intergenic
1043943227 8:86220305-86220327 CAGTTTTCAAAGCTGGGACAGGG + Intronic
1044322478 8:90819797-90819819 CCGTCCTCTCAGGTGGGACAGGG + Intronic
1046272951 8:111919542-111919564 CAGAGCTGACCGCTGGGAAAGGG - Intergenic
1049204258 8:141356083-141356105 CAGGGGCCACAGCTGGGAAATGG - Intergenic
1049207580 8:141370626-141370648 CTGTGCTCACGGCTGGGAAGGGG + Intergenic
1049285473 8:141772769-141772791 CGGGGATCACAGCAGGGACAGGG - Intergenic
1049360835 8:142211905-142211927 CTGTGCTCACAGCTGGGGAGGGG - Intergenic
1049447388 8:142637597-142637619 CTGTGGTCCCAGCTGGGCCATGG - Intergenic
1049578104 8:143398769-143398791 CAGTACCCACAGCTGGGCCTGGG - Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049653749 8:143788776-143788798 CAGTGCTCACAGCTGGTGCGTGG - Intergenic
1049742463 8:144247676-144247698 CAGAGCTCCCAGCTGGTACCTGG - Exonic
1050992475 9:12171334-12171356 ATGTGCTCACCCCTGGGACAAGG - Intergenic
1057220530 9:93255382-93255404 CAGTGCCCAGAGCTGGTAGACGG + Intronic
1057221582 9:93260430-93260452 CAGGGCTCAGAGCTGGGGTAAGG - Intronic
1058152556 9:101478604-101478626 CAGGTGTCACACCTGGGACAAGG + Intronic
1058766696 9:108188903-108188925 CAGGTCACATAGCTGGGACATGG - Intergenic
1059283098 9:113151204-113151226 CATTGCCAACAGCTGGAACAGGG + Intronic
1059413560 9:114149386-114149408 CAGTGCTCACATCTGGAAAATGG + Intergenic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1061015319 9:127977986-127978008 CTGTGCTCACAGCTAGGGCCTGG - Intronic
1061037207 9:128120507-128120529 CAGGGCACACAGCTGGGCCGTGG - Intergenic
1061254006 9:129443201-129443223 CTGTGCCCCCAGCTGGGAGAAGG + Intergenic
1061542366 9:131284394-131284416 CAGGGCCCACAGCTGGTACAAGG - Intergenic
1061642371 9:131969324-131969346 CAGTCCTCTTTGCTGGGACAGGG + Intronic
1061659648 9:132120455-132120477 CAGTGTTCTCAGCTGGGAACTGG - Intergenic
1061838917 9:133346642-133346664 CAGGGCTCTCTGCTGGGCCATGG + Exonic
1062134378 9:134917103-134917125 CAGTGCTCTCACCGGAGACATGG + Intronic
1062351531 9:136142096-136142118 CACTGGTCACAGCTGGGACTAGG - Intergenic
1189343160 X:40219906-40219928 CAGTGGTCACAGCTGAGGCTAGG - Intergenic
1190168614 X:48093706-48093728 CATTTGTCACAGCTGGGACTGGG - Intergenic
1192247263 X:69384114-69384136 CAGCACTCACAGCTGGGAGATGG - Intergenic
1193108006 X:77700868-77700890 CAGTGCTCACAGGGGAGAAAGGG + Intronic
1195705630 X:107736139-107736161 CAGTGCTCAGAGGTGTGTCATGG - Intronic
1198618272 X:138481243-138481265 CAGGGCTCATAGCAGGGTCAGGG - Intergenic
1198963569 X:142205730-142205752 CAGAGCTGGCAGCAGGGACAGGG + Intergenic
1200032587 X:153308192-153308214 CAGTTCTCACATCTGGGTCCAGG + Intergenic
1200038834 X:153351048-153351070 CACTGCTCCCAGCTGGGACGTGG + Exonic