ID: 1181020372

View in Genome Browser
Species Human (GRCh38)
Location 22:20098248-20098270
Sequence GTCTGTCATCTCAACAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60197
Summary {0: 1, 1: 1, 2: 206, 3: 4522, 4: 55467}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181020372_1181020376 19 Left 1181020372 22:20098248-20098270 CCCAAATTGTTGAGATGACAGAC 0: 1
1: 1
2: 206
3: 4522
4: 55467
Right 1181020376 22:20098290-20098312 ATACTTCAGTTCTTTAGACATGG 0: 1
1: 1
2: 5
3: 33
4: 278
1181020372_1181020374 -8 Left 1181020372 22:20098248-20098270 CCCAAATTGTTGAGATGACAGAC 0: 1
1: 1
2: 206
3: 4522
4: 55467
Right 1181020374 22:20098263-20098285 TGACAGACGTGCCACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181020372 Original CRISPR GTCTGTCATCTCAACAATTT GGG (reversed) Intronic
Too many off-targets to display for this crispr