ID: 1181020374

View in Genome Browser
Species Human (GRCh38)
Location 22:20098263-20098285
Sequence TGACAGACGTGCCACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181020367_1181020374 24 Left 1181020367 22:20098216-20098238 CCTAGGCTCAAGCAATCTGCCCA 0: 56
1: 881
2: 5947
3: 22156
4: 51970
Right 1181020374 22:20098263-20098285 TGACAGACGTGCCACTGTGCTGG No data
1181020373_1181020374 -9 Left 1181020373 22:20098249-20098271 CCAAATTGTTGAGATGACAGACG 0: 1
1: 0
2: 86
3: 2272
4: 31566
Right 1181020374 22:20098263-20098285 TGACAGACGTGCCACTGTGCTGG No data
1181020370_1181020374 1 Left 1181020370 22:20098239-20098261 CCTCAGCCTCCCAAATTGTTGAG 0: 13
1: 872
2: 17329
3: 139203
4: 362868
Right 1181020374 22:20098263-20098285 TGACAGACGTGCCACTGTGCTGG No data
1181020371_1181020374 -5 Left 1181020371 22:20098245-20098267 CCTCCCAAATTGTTGAGATGACA 0: 1
1: 69
2: 3249
3: 53508
4: 373294
Right 1181020374 22:20098263-20098285 TGACAGACGTGCCACTGTGCTGG No data
1181020369_1181020374 4 Left 1181020369 22:20098236-20098258 CCACCTCAGCCTCCCAAATTGTT 0: 108
1: 6047
2: 79509
3: 180543
4: 188546
Right 1181020374 22:20098263-20098285 TGACAGACGTGCCACTGTGCTGG No data
1181020368_1181020374 5 Left 1181020368 22:20098235-20098257 CCCACCTCAGCCTCCCAAATTGT 0: 78
1: 3808
2: 50207
3: 184281
4: 373479
Right 1181020374 22:20098263-20098285 TGACAGACGTGCCACTGTGCTGG No data
1181020372_1181020374 -8 Left 1181020372 22:20098248-20098270 CCCAAATTGTTGAGATGACAGAC 0: 1
1: 1
2: 206
3: 4522
4: 55467
Right 1181020374 22:20098263-20098285 TGACAGACGTGCCACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181020374 Original CRISPR TGACAGACGTGCCACTGTGC TGG Intronic
No off target data available for this crispr