ID: 1181020376

View in Genome Browser
Species Human (GRCh38)
Location 22:20098290-20098312
Sequence ATACTTCAGTTCTTTAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 5, 3: 33, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181020372_1181020376 19 Left 1181020372 22:20098248-20098270 CCCAAATTGTTGAGATGACAGAC 0: 1
1: 1
2: 206
3: 4522
4: 55467
Right 1181020376 22:20098290-20098312 ATACTTCAGTTCTTTAGACATGG 0: 1
1: 1
2: 5
3: 33
4: 278
1181020373_1181020376 18 Left 1181020373 22:20098249-20098271 CCAAATTGTTGAGATGACAGACG 0: 1
1: 0
2: 86
3: 2272
4: 31566
Right 1181020376 22:20098290-20098312 ATACTTCAGTTCTTTAGACATGG 0: 1
1: 1
2: 5
3: 33
4: 278
1181020370_1181020376 28 Left 1181020370 22:20098239-20098261 CCTCAGCCTCCCAAATTGTTGAG 0: 13
1: 872
2: 17329
3: 139203
4: 362868
Right 1181020376 22:20098290-20098312 ATACTTCAGTTCTTTAGACATGG 0: 1
1: 1
2: 5
3: 33
4: 278
1181020371_1181020376 22 Left 1181020371 22:20098245-20098267 CCTCCCAAATTGTTGAGATGACA 0: 1
1: 69
2: 3249
3: 53508
4: 373294
Right 1181020376 22:20098290-20098312 ATACTTCAGTTCTTTAGACATGG 0: 1
1: 1
2: 5
3: 33
4: 278
1181020375_1181020376 -7 Left 1181020375 22:20098274-20098296 CCACTGTGCTGGCATTATACTTC No data
Right 1181020376 22:20098290-20098312 ATACTTCAGTTCTTTAGACATGG 0: 1
1: 1
2: 5
3: 33
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181020376 Original CRISPR ATACTTCAGTTCTTTAGACA TGG Intronic
900668306 1:3831193-3831215 AGACTTAACTTCTTTAAACAAGG + Exonic
903254754 1:22088269-22088291 ATACCTCTGTTCTCTAGATATGG + Intronic
904105168 1:28074467-28074489 TTACTTTAGTTATTTAGACATGG + Intronic
904862717 1:33550840-33550862 ATACTTCAGTATTTTAGTAAAGG - Intronic
906697688 1:47835016-47835038 TTTCTTTAGTTCTTCAGACATGG - Intronic
908340041 1:63168653-63168675 AAACTACATTTATTTAGACATGG - Intergenic
910471350 1:87556328-87556350 ATACTGCATTTCTTTAGTAATGG - Intergenic
910776341 1:90879992-90880014 ATACTTTAGTTCTTTAAATGTGG + Intergenic
911807649 1:102232284-102232306 CTGATTCAGTTCTTGAGACAGGG + Intergenic
913094286 1:115501983-115502005 ATACTTCTGGTCTTCAGACTTGG - Intergenic
916268168 1:162913086-162913108 TTTCATTAGTTCTTTAGACATGG + Intergenic
917581462 1:176382545-176382567 TTACTTCAGTGCTTAAGACTTGG + Intergenic
918037645 1:180891187-180891209 ATACTTTATTTCTTAAGAGATGG + Intergenic
918578547 1:186096495-186096517 ATACTTCATTTATTTAGATATGG - Intronic
918712155 1:187744903-187744925 ACACTTCAGTTTTTCACACATGG + Intergenic
918989193 1:191675975-191675997 TTATTCCAGTTCTTGAGACAGGG + Intergenic
919299492 1:195742141-195742163 ATACATCATTTTTGTAGACAAGG + Intergenic
919537578 1:198807123-198807145 ATAAAGCAGTTCTCTAGACAAGG - Intergenic
920737967 1:208552501-208552523 AAACTTCAATACTTTAGAAAAGG - Intergenic
920904133 1:210144391-210144413 ATACTTCAGTTATCTAAAAAAGG - Intronic
921087899 1:211813397-211813419 ATAATTCAGATGTTTAGACAAGG + Intronic
922863188 1:228837024-228837046 ATAATTCAGTCCTTAAGAGATGG + Intergenic
1064882871 10:20076339-20076361 ATACTTCAGTTCATAAGCCAAGG + Intronic
1065444151 10:25780343-25780365 TTACTTCAGCTCTTTAAAAATGG + Intergenic
1066392793 10:34991921-34991943 ATTCTTGATTTCTTTAGCCAAGG - Intergenic
1067150328 10:43727437-43727459 TTCCTTTAGTTCTTTAGATATGG - Intergenic
1067492819 10:46728215-46728237 ATTCATAATTTCTTTAGACATGG - Intergenic
1067601845 10:47612180-47612202 ATTCATAATTTCTTTAGACATGG + Intergenic
1069523700 10:69148406-69148428 ATAGTTTAGTTCTTTAAGCAAGG + Intronic
1070233477 10:74596854-74596876 ATACTTTAGAGCTTTATACATGG + Intronic
1070939503 10:80330975-80330997 TTCCTTTACTTCTTTAGACATGG - Intergenic
1071085096 10:81860923-81860945 TTCGTTTAGTTCTTTAGACATGG + Intergenic
1071653371 10:87419768-87419790 ATTCATAATTTCTTTAGACATGG + Intergenic
1073331134 10:102670420-102670442 ATATTTCATTTCTTTAGCAAAGG + Intergenic
1073389422 10:103161182-103161204 ATATTTTTTTTCTTTAGACAAGG + Intronic
1074084700 10:110200538-110200560 ATTCTTAAATTCTTTGGACATGG - Intergenic
1074278452 10:112027205-112027227 AGACTTCAGTTGTTTACCCAAGG + Intergenic
1075400465 10:122157797-122157819 ATATTTCAGCTCTTTTGAGACGG - Intronic
1075933045 10:126315485-126315507 ATACTTCAGTTGCCCAGACAGGG - Intronic
1078119169 11:8488955-8488977 CTCTTTTAGTTCTTTAGACATGG - Intronic
1080189970 11:29533222-29533244 ATCCTTAACTTCTTTTGACAAGG + Intergenic
1080763589 11:35275762-35275784 AAACTTCACCTCTTTAGCCAAGG - Intronic
1081067452 11:38563224-38563246 AAACCTCAGTTCTTTAGAGGTGG + Intergenic
1081948989 11:47026373-47026395 ATCCTTCAGTTCTTTCAACAAGG - Intronic
1084926048 11:72512428-72512450 ATGCTTTACTTCTTTAAACAAGG + Intergenic
1084992153 11:72936829-72936851 TCCCTTCAGTTCTTCAGACATGG + Intronic
1085257767 11:75185919-75185941 ATGCTTCTGTTCTCCAGACATGG + Intronic
1085629812 11:78105495-78105517 ATTCTTCAGATGTTAAGACAGGG + Intronic
1089043820 11:115481272-115481294 ATACCTAAGTTCTATAGCCATGG + Intronic
1089757691 11:120698512-120698534 ATCTTTAAGTTCTTTACACAGGG + Intronic
1093680733 12:21999216-21999238 GTACTTCAGTTGTTGATACAAGG - Intergenic
1096998111 12:55852429-55852451 ATCCTTCTTTTCTTGAGACAAGG - Intergenic
1098894831 12:76046416-76046438 CTACTTCAGTTCATTAAAAATGG + Exonic
1100102383 12:91124673-91124695 ATATTTCTGTTGTTCAGACATGG + Intergenic
1101476620 12:105055672-105055694 TTCCTTTAATTCTTTAGACATGG - Intronic
1104941295 12:132396683-132396705 AGAGCTCAGTTCTTGAGACACGG + Intergenic
1105950650 13:25226613-25226635 AAACTGCAGTTGTTTTGACAGGG - Intergenic
1106341356 13:28830384-28830406 CTACTTTAATTCTTCAGACAAGG - Intronic
1107166445 13:37286858-37286880 TTCATTTAGTTCTTTAGACATGG + Intergenic
1107371582 13:39756075-39756097 ATACTTTAGTTCTTCAGACTTGG - Intronic
1107665110 13:42680430-42680452 TGACTTCAAGTCTTTAGACAAGG + Intergenic
1107796244 13:44054974-44054996 ATTCTTCAGTTATGTACACAAGG + Intergenic
1108130110 13:47289755-47289777 ATACTTTGGTTCCTTTGACATGG - Intergenic
1109330429 13:60922445-60922467 ATCCTCAAGTTCTTTAGTCATGG + Intergenic
1109977171 13:69853529-69853551 ACACTTCTGTTCTTTACACATGG + Intronic
1111663291 13:91237344-91237366 ATACTTGATTTCTGTAGTCATGG - Intergenic
1112249080 13:97762376-97762398 TTCCTTTAGTTCTCTAGACATGG - Intergenic
1112850330 13:103698516-103698538 AAACTTAAGTTTTTAAGACATGG + Intergenic
1113560639 13:111277499-111277521 ATACTTCACTTATTTATACTAGG - Intronic
1113837760 13:113340013-113340035 ATTAATCAGTTATTTAGACAGGG + Intronic
1114151670 14:20047453-20047475 TTCCTTTAATTCTTTAGACATGG + Intergenic
1115100535 14:29692932-29692954 ATACTTCACTTCTTTATATGTGG - Intronic
1115166497 14:30453811-30453833 ACAATTCAGTTCATAAGACAAGG + Intergenic
1116184434 14:41578715-41578737 TTCCTTTAGTTCTTTAAACACGG - Intergenic
1116890813 14:50266345-50266367 ATACTTTAGTTGTTTAGGCAGGG + Intronic
1117652279 14:57919494-57919516 ATACTTCACTTCTGCAGGCAGGG + Intronic
1119451580 14:74716238-74716260 ATACTTCAATTCATTAAACATGG - Intronic
1119893068 14:78197561-78197583 AGACTTGGGTACTTTAGACATGG - Intergenic
1120393583 14:83939467-83939489 ATACATCGGGTCTTCAGACAAGG - Intergenic
1120853430 14:89191401-89191423 ACACTTCATTTATTTGGACAGGG - Intronic
1124469724 15:29972778-29972800 TTCCTTTAGTTCATTAGACATGG - Intergenic
1124789541 15:32715098-32715120 ATACTTTTTTTCTTTAGAAAGGG + Intergenic
1128141695 15:65305911-65305933 TTACTTTAGTTTTTGAGACAGGG + Intergenic
1130291382 15:82604516-82604538 ATACTTTAGTTCCTTGGATATGG - Intronic
1131112295 15:89772607-89772629 ATAATTTTTTTCTTTAGACAGGG - Intronic
1131574295 15:93571061-93571083 ATACATCAGATCTATAGATAAGG - Intergenic
1131589498 15:93732697-93732719 ATAATTTTTTTCTTTAGACAGGG + Intergenic
1131920903 15:97327782-97327804 ATACTTCTTTTCATCAGACATGG - Intergenic
1132752184 16:1463479-1463501 ATAATTAATTTTTTTAGACAGGG + Intronic
1134874064 16:17680783-17680805 TTCCTTTATTTCTTTAGACATGG + Intergenic
1135225328 16:20650982-20651004 TTACTTCAGTACTTTAGCCATGG - Intronic
1135464234 16:22671547-22671569 ATACTCCAGTTCTTCAGGCCTGG + Intergenic
1135478789 16:22803211-22803233 TTATTTCATTCCTTTAGACATGG - Intergenic
1138364582 16:56463849-56463871 ATACTTCAGTAATTTCTACAAGG + Intronic
1138484989 16:57334874-57334896 ATATTTTAATTCTTTAGACATGG + Intergenic
1138628505 16:58273588-58273610 TTACTTTAATTCTTTAAACATGG + Intronic
1138851915 16:60639928-60639950 AGACTTCAGTTCCTTATACTTGG + Intergenic
1139682665 16:68577367-68577389 TTCCTTTAGTTCTCTAGACATGG - Intergenic
1143237207 17:5413035-5413057 ATTCTTATTTTCTTTAGACAGGG + Intronic
1144103602 17:11965702-11965724 TTTCTTTAGTTATTTAGACATGG - Intronic
1146622713 17:34411956-34411978 AGACCTCAGAGCTTTAGACAAGG - Intergenic
1148520165 17:48266171-48266193 ATACTTCAGTTGAATAGACTAGG - Intronic
1148937278 17:51173503-51173525 ATACTTTATTTTTTTAGAGATGG + Intergenic
1151844978 17:76647051-76647073 AATCTTCAATTCTTTAAACATGG + Intergenic
1152409439 17:80115478-80115500 TTCCTTTAGTTCTTCAGACACGG + Intergenic
1152997017 18:416971-416993 TTACTGCAGTTCTTTAAACCTGG - Intronic
1153603772 18:6810229-6810251 ATCCTTCATTCCTTTATACATGG - Intronic
1153888316 18:9488034-9488056 TTCCTTCAGTTTTTAAGACATGG + Intronic
1155181254 18:23349895-23349917 TTGCTTCAATTCTTTAAACATGG + Intronic
1155606336 18:27610424-27610446 ATACCTCAGTTTTTTAAAAAAGG - Intergenic
1155770352 18:29690292-29690314 ATACTTCCGTTCTGTGGTCATGG - Intergenic
1156376262 18:36518068-36518090 AAACTTCAGTTTTTCTGACAAGG - Intronic
1157434727 18:47658721-47658743 GTACTTTAGTTTTTGAGACAGGG - Intergenic
1157836257 18:50906081-50906103 TTCCTTTAGTTCTTTAGACATGG + Intronic
1158143904 18:54288858-54288880 TTACTTTAATTCTTTAAACATGG + Intronic
1158227114 18:55212995-55213017 AGACTTCAGTTCTCTGGACCTGG + Intergenic
1158569711 18:58587491-58587513 TTTTTTCAGCTCTTTAGACATGG - Intronic
1159806128 18:72960454-72960476 ATACTTCATTGCTTTAGCCCAGG - Intergenic
1161415391 19:4143989-4144011 ATACTTCAGTTCTTGGGGCCTGG + Intergenic
1164281972 19:23777117-23777139 ATCCTTCAGTTATTTTCACAAGG + Intronic
925684295 2:6455698-6455720 ATTATTTAATTCTTTAGACATGG - Intergenic
928582474 2:32723194-32723216 AAACTTAAGTTCTTTGGACAAGG + Intronic
929380220 2:41341416-41341438 AGACTTTAGAACTTTAGACACGG - Intergenic
929386555 2:41414752-41414774 TTTCTTCAGTCCTCTAGACATGG + Intergenic
929424501 2:41830297-41830319 ATGCATCAGTTCATCAGACATGG + Intergenic
930376697 2:50576277-50576299 ATACTGCAGTTTTTTAGTTATGG + Intronic
931157146 2:59648030-59648052 TTCCTTTAGTTATTTAGACATGG - Intergenic
931765964 2:65456763-65456785 ACACTGCAGGTCTTTTGACATGG - Intergenic
932919460 2:75893865-75893887 TTACTTCAGTTCTTTAGACATGG + Intergenic
933196802 2:79399845-79399867 ATCCTTTACTTCTTTACACAAGG - Intronic
934689810 2:96349816-96349838 ATGCTTCAGTTCTTTATACCAGG + Intronic
935441932 2:103109092-103109114 TTTCTTTAGTTCTTTAGAAATGG + Intergenic
936231402 2:110703167-110703189 ATACTTCAATTCTAAAGAAAAGG - Intergenic
936294172 2:111253195-111253217 TTCCTTTAGTTATTTAGACATGG + Intergenic
936599057 2:113877553-113877575 ATTCTTCATTTTTTTAGACGAGG + Intergenic
936743946 2:115550851-115550873 GGAGTTCAGTTCTTTAAACAAGG - Intronic
937642140 2:124225412-124225434 TAACTTCAGTGTTTTAGACAGGG + Intronic
938205573 2:129419256-129419278 TTCCTATAGTTCTTTAGACATGG + Intergenic
938670318 2:133580315-133580337 ATACTTCAAGTCTTTGGTCAAGG + Intergenic
939070947 2:137541700-137541722 ATACTTTAGTTCTTTAGATATGG - Intronic
939942705 2:148369431-148369453 ATACTTCATTTCCTTAGAACAGG - Intronic
940459492 2:153945983-153946005 ATACTTCAGTTATTCTGAGAGGG + Intronic
940537289 2:154961240-154961262 TTACTCCTGATCTTTAGACAAGG - Intergenic
941101874 2:161305856-161305878 TTCCTCTAGTTCTTTAGACATGG + Intergenic
941620360 2:167771104-167771126 ATAATTCAGTTCTTTGGGCTGGG + Intergenic
941835337 2:170011164-170011186 ATTTTTTATTTCTTTAGACAGGG - Intronic
942008657 2:171736302-171736324 ATACTAGAGTTGATTAGACAGGG + Intronic
944405963 2:199384037-199384059 ATACCTCAATTTTTTAGAGAGGG + Intronic
944824938 2:203473277-203473299 ATACTTTATTTTTTGAGACAGGG - Intronic
945106413 2:206319981-206320003 ATATTTTAATTCTTTAGACCTGG - Intergenic
945371966 2:209029957-209029979 TTAATGCAGTTCTTCAGACATGG - Intergenic
1169710631 20:8558380-8558402 ATCCTTCAGTTCTTTGTCCATGG - Intronic
1169757479 20:9058788-9058810 ATACTGCAGTTGTTTTGGCAAGG + Intergenic
1170390868 20:15872834-15872856 ATCCTTCTGATCTTTAGAAATGG + Intronic
1170527581 20:17256273-17256295 TTCCTTTAGTTCTTTAGATATGG + Intronic
1173448988 20:43145473-43145495 ATCCTTGAGTTCTTCAGTCAAGG - Intronic
1174900488 20:54494458-54494480 ATGCTTCAGTCATTAAGACAGGG - Intronic
1176903974 21:14477685-14477707 ACAGTTCAGTTGTTTAGATAGGG - Intergenic
1177510704 21:22083855-22083877 ATAATTCAGTAATTAAGACATGG + Intergenic
1178276427 21:31242150-31242172 ATACTTTATTTCTTTAGACATGG - Intronic
1179019781 21:37628275-37628297 TTCCTTTTGTTCTTTAGACATGG - Intronic
1179322080 21:40301785-40301807 TTACTTCAGTTTTATAGACTAGG + Intronic
1179989721 21:44941149-44941171 TTCGTTTAGTTCTTTAGACACGG + Intronic
1180112414 21:45667578-45667600 ATTCTTTAATCCTTTAGACATGG + Intronic
1181020376 22:20098290-20098312 ATACTTCAGTTCTTTAGACATGG + Intronic
949276376 3:2287594-2287616 CTCCTTCTTTTCTTTAGACAGGG - Intronic
949560813 3:5200669-5200691 CTACTTCAGATCTTTAGAATGGG + Intronic
950973872 3:17219322-17219344 TTCCTTTAGTTCTTTAGACAGGG + Intronic
951103093 3:18711921-18711943 AAACTTCAGTTTTTTATAAACGG - Intergenic
953279840 3:41543932-41543954 TTCCTTTAATTCTTTAGACATGG + Intronic
955760060 3:62270489-62270511 ATATTTCAGGTATTTAAACAGGG + Intronic
955998421 3:64702123-64702145 ATATTACAGTTATTTAGTCAGGG + Intergenic
958604055 3:96335435-96335457 ATCCTTTAGTTATTTATACAAGG - Intergenic
958635877 3:96745436-96745458 ATAATTCAGTGATTTATACAAGG + Intergenic
959179610 3:102961592-102961614 ATACTTCTGATCTATAAACATGG + Intergenic
960402929 3:117225685-117225707 ATGCATCACTACTTTAGACATGG - Intergenic
960470978 3:118064783-118064805 ATACTTCAAATTTTTGGACATGG + Intergenic
960738661 3:120808804-120808826 CTACTTCAGTTCATTAGAAATGG - Intergenic
961848513 3:129790953-129790975 ATACTTCAGCTCTATAGGAAAGG + Intronic
967313293 3:188126895-188126917 AGACTTCAGTCCTTTAGAGCTGG - Intergenic
970109341 4:12620032-12620054 ATAAAACAGATCTTTAGACAAGG + Intergenic
970628736 4:17918452-17918474 ATACTTTAGTTGTTTATACATGG - Intronic
973100808 4:46267363-46267385 TTCCTTTAGTTCTTTCGACAGGG + Intronic
974852987 4:67426346-67426368 ATAGTTCAGTTGTTTATATAAGG - Intergenic
975499611 4:75070269-75070291 TTACTTCAGTTTTTTACCCATGG + Intergenic
975873632 4:78809760-78809782 TTACTTTAGTTCTTTAGACATGG + Intronic
976960514 4:90965851-90965873 TTCGTTTAGTTCTTTAGACATGG - Intronic
979024274 4:115548244-115548266 ATACTTCAGTTCCATAGCTAAGG - Intergenic
979436122 4:120693748-120693770 ATACTTCCTTTCTTTTGACTGGG + Exonic
979604967 4:122628439-122628461 TTACTTCAATTCTTTAAATATGG + Intergenic
981707938 4:147680993-147681015 TTGCTTCAGTTCTTTGCACAAGG - Intronic
981709780 4:147697868-147697890 TTACTTTAGTTCTTAAGACATGG - Intergenic
981960756 4:150535784-150535806 ATACTTTCGTTCTTAAGACAAGG + Intronic
982548328 4:156762755-156762777 GTATTTCAGTTCTTTCGATACGG - Exonic
982663934 4:158237950-158237972 ATACTTCTGTTCTTTTAAAAAGG + Intronic
982673998 4:158354828-158354850 ATCCTTCAATTCTTTCCACAAGG + Intronic
983692041 4:170482262-170482284 TTTCTTCAGTTTTTGAGACAGGG + Intergenic
984237164 4:177173559-177173581 TTATTTTAGTTTTTTAGACAGGG - Intergenic
984624029 4:181985839-181985861 ATAATTCAGTACTTTTGTCACGG + Intergenic
984788402 4:183591132-183591154 AAAATTCAGTTATATAGACAAGG - Intergenic
984810941 4:183796402-183796424 ACACCTCAGGTCTTTAGACCCGG + Intergenic
986111197 5:4720151-4720173 ATGCTTCAGTTCTTTGCCCAAGG + Intergenic
988375623 5:30431768-30431790 ATACTGTAGTTCTTTTGATATGG + Intergenic
988666468 5:33333621-33333643 ATCGTTCAGTTCTTCATACATGG + Intergenic
989354134 5:40522382-40522404 AAACTTCAGTTATTTGGAGAGGG + Intergenic
989391633 5:40906517-40906539 TTATTTCAGTAGTTTAGACAAGG - Intergenic
990577176 5:57134826-57134848 CTACTTAAGTCCTTTACACATGG + Intergenic
990591115 5:57266112-57266134 ATATTTCCTTTCTTTAGGCAGGG + Intergenic
991159394 5:63479024-63479046 TTATTTTAATTCTTTAGACATGG - Intergenic
991246407 5:64513077-64513099 ATAGCTCAGTTCTGTAAACAAGG - Intronic
991309951 5:65226925-65226947 AAACTTCTGTTTGTTAGACAAGG - Intronic
993001590 5:82386709-82386731 ATAAATCAGTACTTTTGACAGGG - Intronic
995563558 5:113409356-113409378 ATACTTTTTTTTTTTAGACAGGG + Intronic
996254977 5:121388877-121388899 ATGCTACAGCTATTTAGACAGGG - Intergenic
998362236 5:141598876-141598898 ATACTTCAGCTTTTTAAAAACGG + Intronic
998419541 5:141971246-141971268 ATACTTTATTTTTTGAGACAAGG + Intronic
998442976 5:142177591-142177613 ATTCTTCAGCTCTTTAGAAATGG + Intergenic
1000167104 5:158661070-158661092 ATACTTTAGTTATTTAGATGTGG - Intergenic
1001351471 5:170971398-170971420 ATCCTTCCTTTCTGTAGACATGG + Intronic
1002811970 6:639540-639562 ATGCTTCAGTTGTGTGGACAGGG - Intronic
1003037212 6:2652902-2652924 TTCCTTTAATTCTTTAGACATGG - Intergenic
1003262377 6:4530970-4530992 TTCCTTTAGCTCTTTAGACATGG - Intergenic
1003264654 6:4554530-4554552 ATACTTCTGATTTTTATACAAGG + Intergenic
1004046556 6:12030681-12030703 ATACTTTAATTCTTTAAATATGG + Intronic
1005777304 6:29149121-29149143 TTCCTTTAGTTCTTTAAACATGG + Intergenic
1005815149 6:29545230-29545252 TTCCTTTAGTTCTTTTGACATGG - Intergenic
1007855870 6:44856400-44856422 ATACTCAAGATCATTAGACATGG + Intronic
1008135239 6:47768582-47768604 ATTCTTCAGATCGTTAGTCATGG + Intergenic
1008217567 6:48813372-48813394 AAACTTCAGTTCTATAGAAATGG - Intergenic
1011514221 6:88134863-88134885 ATCCTCCAGTTCTTAAGACAGGG - Intergenic
1012029539 6:94040619-94040641 CTACTTTACTTCTTTAGACATGG + Intergenic
1012032592 6:94091264-94091286 ATATTTCAGGTCTCTAGACCTGG - Intergenic
1012489896 6:99770750-99770772 TTCCTTTAGTTCTCTAGACATGG + Intergenic
1013787388 6:113796897-113796919 ATTCTTTTCTTCTTTAGACAGGG + Intergenic
1015665276 6:135621215-135621237 ATACTTTATTTCATTAAACATGG - Intergenic
1016942684 6:149496481-149496503 ATACTTTATTTATTTAGAGATGG + Intergenic
1017234724 6:152107507-152107529 ATACTCTAATTCTTTAAACATGG + Intronic
1017932441 6:158969914-158969936 TTACTTTAATTCTTTAGACATGG + Intergenic
1018567842 6:165174831-165174853 TTACTTTAGTTTTTTAGACATGG - Intergenic
1021553519 7:21897066-21897088 ATACTTTATTTTTTGAGACAGGG - Intronic
1021598773 7:22343464-22343486 ATATTTCATTTATTAAGACAAGG + Intronic
1022876498 7:34537738-34537760 TTACCTCACTTCTTTAGAGAGGG - Intergenic
1023478756 7:40610084-40610106 ATACTTCAGTTTTTAAAATATGG - Intronic
1025990469 7:66493188-66493210 ATAGTTTATTTTTTTAGACAAGG + Intergenic
1026885528 7:73941183-73941205 TTCCTTTAGTTCTTTAGACATGG + Intergenic
1027213133 7:76166201-76166223 ATAGTTTATTTTTTTAGACAAGG + Intergenic
1027454090 7:78365500-78365522 TTACTTAACTTCTTTAGCCAGGG + Intronic
1027618173 7:80449944-80449966 AGAGTTCACTTCTTAAGACAAGG - Intronic
1027847724 7:83404449-83404471 ATACCTCAATTCTCTTGACAGGG - Intronic
1028310121 7:89321063-89321085 ATACTTCATTTCAGTATACATGG - Intronic
1028332828 7:89617605-89617627 AACCTTCTGTTCTTTAGAAATGG + Intergenic
1028415201 7:90572781-90572803 TTACTTGATTTCTTGAGACAGGG - Intronic
1029245564 7:99197562-99197584 GCACTTTAGTTCTTTAGTCATGG - Intronic
1029932480 7:104387105-104387127 TCTCTTCATTTCTTTAGACATGG - Intronic
1031191544 7:118558512-118558534 ATCCTTTAGTTCTTTACACATGG - Intergenic
1031872176 7:127099774-127099796 ATAATTCAGTTCTTAACAGAGGG - Intronic
1032645186 7:133816105-133816127 ACACATCAGTTATTTACACAGGG + Intronic
1033019146 7:137704243-137704265 ATCCTTTAGCTCCTTAGACATGG - Intronic
1033098820 7:138453558-138453580 TTACTTCTGTTCTTCAGAGAGGG + Intergenic
1036084692 8:5600566-5600588 ATCTTTCAGTTTCTTAGACAGGG - Intergenic
1036532395 8:9604878-9604900 ATACTTCAGTACTTCAGTCTTGG + Intronic
1036954234 8:13170184-13170206 ATACTAAAATTCTTTAGAGATGG + Intronic
1037224089 8:16562668-16562690 TTCCTTTAGTTATTTAGACAAGG - Intronic
1038319949 8:26516871-26516893 ATATTTCATGTCTTTAGAAAAGG + Intronic
1039141301 8:34391721-34391743 AGACTTCAGTTCTTTCCATATGG + Intergenic
1039205589 8:35150002-35150024 ATTCTCTAGTTCTTTAGACCAGG + Intergenic
1040462752 8:47664419-47664441 TTCCTTTAATTCTTTAGACATGG - Intronic
1040790624 8:51224679-51224701 ATACTTTAATTCGTTAGATATGG - Intergenic
1041806989 8:61862345-61862367 ATTATCCAGTTTTTTAGACAAGG + Intergenic
1042079013 8:65029011-65029033 TTCCTTTAGTTATTTAGACATGG - Intergenic
1042450426 8:68938926-68938948 AGACTTAAGTTCTCTTGACAAGG + Intergenic
1042767206 8:72336397-72336419 CTCCTTTAATTCTTTAGACATGG + Intergenic
1043577464 8:81674525-81674547 AGACTCCAATTCTTCAGACAAGG - Intronic
1044328449 8:90888342-90888364 AAAGTTCAGTTCTTCAGAAATGG - Intronic
1044902994 8:96969126-96969148 ATCTTTCATTTCTTTAGACCTGG - Intronic
1045178696 8:99756085-99756107 ATACTTAAGCTTTTTAGACATGG - Intronic
1045394874 8:101750628-101750650 TTGCTTCAGTTCTAGAGACAAGG + Intronic
1045446842 8:102275083-102275105 ATTCCTGAGTTCTTTTGACATGG - Intronic
1045675157 8:104599403-104599425 TTAATTCAGTTGTTTAGAAAGGG + Intronic
1045995391 8:108356426-108356448 ATACTTCTTTTCTCTAGAAATGG - Intronic
1048566553 8:135605538-135605560 ATACTTTAGTTGGTTAGAAAGGG + Intronic
1049754854 8:144306147-144306169 ATACTTTAGTTCTTCAGATGTGG + Intronic
1051670769 9:19508005-19508027 ATACTTTTGTTCTTCAGATACGG - Exonic
1055475118 9:76655546-76655568 AGACTTCATTTCTTTTGAAAAGG + Intronic
1056036280 9:82609473-82609495 ATACTTCCCTTGTTTAGTCAGGG - Intergenic
1056770232 9:89473079-89473101 ATACTTTATTTGTTGAGACAGGG - Intronic
1056860972 9:90181378-90181400 ATACTACAGTACTTTATAGAGGG - Intergenic
1057056182 9:91962892-91962914 ATACTCTATTTCTTTAGACATGG + Intergenic
1057837909 9:98461320-98461342 ATACTTCAGTAATTAAAACAGGG + Intronic
1057947287 9:99340633-99340655 ATACAGCAGGTCTTCAGACAAGG + Intergenic
1057979737 9:99648807-99648829 TTCCTTTAGTTCTTTAGACATGG - Intergenic
1058252466 9:102717456-102717478 ATAATTCTGTTATTTAGTCAGGG + Intergenic
1058431208 9:104921561-104921583 ATACTTAAGTTATTTAGGCCAGG - Intronic
1058433252 9:104938084-104938106 ATACTTTATTTTTTGAGACAGGG + Intergenic
1061524888 9:131152116-131152138 ATACTTTTTTTCTTGAGACAGGG + Intronic
1062666545 9:137676370-137676392 ATATTTTATTTTTTTAGACAGGG + Intronic
1186086606 X:5996907-5996929 CTACTTCAGTTTTTTAAAAAAGG - Intronic
1186585413 X:10867995-10868017 AGACTTTGGTTCTTTAGATATGG + Intergenic
1189094679 X:38125632-38125654 ATACTTCATTCCTTTAGCTAAGG + Intronic
1190572614 X:51799392-51799414 GCCCTTCAGTTCTTTAGATATGG - Intergenic
1191870616 X:65742035-65742057 ATACCTCAGTTCTATGGAGAGGG + Intergenic
1192103036 X:68285930-68285952 TTTCTTAAGTTCTTTAGACATGG + Intronic
1192841015 X:74856166-74856188 CTACTTTAGTTCTTTAGACATGG - Intronic
1193226284 X:78988109-78988131 ATATTTCACCTCTGTAGACAAGG - Intergenic
1195620442 X:106949280-106949302 CTACTTTAATTCTTTAGACATGG + Intronic
1195791656 X:108594863-108594885 ATATTTAATTTTTTTAGACAGGG + Intronic
1196328158 X:114433615-114433637 ATACTTGAGTTCATTATCCAAGG - Intergenic
1198044382 X:132886173-132886195 ATACTTCAACTCTTTAAACGTGG - Intronic
1198234926 X:134727883-134727905 ATATTTTAGTTCTTTAGACATGG - Intronic
1198463006 X:136881000-136881022 AAACTTCAGTTCTTTATTAAAGG - Intergenic
1198501004 X:137246474-137246496 AAATTTCAGTTCCTTAGACAAGG + Intergenic
1199281386 X:146004108-146004130 CAATTTCAGTTCTTTAAACAAGG - Intergenic
1199368975 X:147022365-147022387 GGACTTCAGTTCTTTAGGAATGG - Intergenic
1199854392 X:151748369-151748391 CTACTTCAGTTCATTAAAAACGG + Intergenic
1202275224 Y:23111185-23111207 AGAGTTCAGATCTTTTGACAGGG - Intergenic
1202290804 Y:23309506-23309528 AGAGTTCAGATCTTTTGACAGGG + Intergenic
1202428215 Y:24744904-24744926 AGAGTTCAGATCTTTTGACAGGG - Intergenic
1202442576 Y:24925185-24925207 AGAGTTCAGATCTTTTGACAGGG + Intergenic