ID: 1181022806

View in Genome Browser
Species Human (GRCh38)
Location 22:20112519-20112541
Sequence CAGGAGCTGAAGGGCTCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 284}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181022806_1181022818 3 Left 1181022806 22:20112519-20112541 CCCTGGGAGCCCTTCAGCTCCTG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 1181022818 22:20112545-20112567 CCATAATGGGTCCTGGGCCTAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1181022806_1181022813 -4 Left 1181022806 22:20112519-20112541 CCCTGGGAGCCCTTCAGCTCCTG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 1181022813 22:20112538-20112560 CCTGTCCCCATAATGGGTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 134
1181022806_1181022823 15 Left 1181022806 22:20112519-20112541 CCCTGGGAGCCCTTCAGCTCCTG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 1181022823 22:20112557-20112579 CTGGGCCTAGGATGAGGGGAAGG 0: 1
1: 0
2: 3
3: 47
4: 450
1181022806_1181022819 9 Left 1181022806 22:20112519-20112541 CCCTGGGAGCCCTTCAGCTCCTG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 1181022819 22:20112551-20112573 TGGGTCCTGGGCCTAGGATGAGG 0: 1
1: 0
2: 1
3: 35
4: 340
1181022806_1181022811 -10 Left 1181022806 22:20112519-20112541 CCCTGGGAGCCCTTCAGCTCCTG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 1181022811 22:20112532-20112554 TCAGCTCCTGTCCCCATAATGGG 0: 1
1: 0
2: 0
3: 14
4: 138
1181022806_1181022821 11 Left 1181022806 22:20112519-20112541 CCCTGGGAGCCCTTCAGCTCCTG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 1181022821 22:20112553-20112575 GGTCCTGGGCCTAGGATGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 238
1181022806_1181022820 10 Left 1181022806 22:20112519-20112541 CCCTGGGAGCCCTTCAGCTCCTG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 1181022820 22:20112552-20112574 GGGTCCTGGGCCTAGGATGAGGG 0: 1
1: 0
2: 0
3: 26
4: 276
1181022806_1181022814 -3 Left 1181022806 22:20112519-20112541 CCCTGGGAGCCCTTCAGCTCCTG 0: 1
1: 0
2: 2
3: 32
4: 284
Right 1181022814 22:20112539-20112561 CTGTCCCCATAATGGGTCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181022806 Original CRISPR CAGGAGCTGAAGGGCTCCCA GGG (reversed) Exonic
900578374 1:3395354-3395376 CAGAAAGGGAAGGGCTCCCAGGG - Intronic
900682606 1:3925106-3925128 CAGGTGCTGAGGGCCACCCAGGG - Intergenic
901003795 1:6161857-6161879 TAGCAGCTGAAGGCCACCCAGGG - Intronic
901228813 1:7630690-7630712 AAGGTGCTGCAGGGCCCCCAAGG + Intronic
901327499 1:8376862-8376884 CAGGTGTTGGAGGGATCCCAGGG + Intronic
902239312 1:15077760-15077782 AAGCAGCTGCAGGCCTCCCAGGG + Intronic
902565679 1:17309864-17309886 CAGGAGCTGAAGCTAGCCCAGGG + Intronic
902952692 1:19899017-19899039 CAGGAGCTGGAGGGCAGCCTGGG - Intronic
903676646 1:25068578-25068600 CAGGAGCTGCAGAGAACCCAAGG + Intergenic
903780628 1:25817985-25818007 CAGCAGGAGAAGGGCTCGCATGG - Exonic
903968230 1:27102738-27102760 CAGGAACTGAAAGGGGCCCAGGG + Exonic
905774369 1:40659082-40659104 GAGGAGCGGAAGGGCTCCACAGG + Intronic
905824460 1:41018023-41018045 CAGCAGCTGCAGAGCTGCCAGGG - Exonic
905869593 1:41395417-41395439 CTGGAGCTGGAGAGCTCCCCGGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906832865 1:49051921-49051943 CAGGGGCTGATGGGCACTCAGGG + Intronic
907912822 1:58841625-58841647 CAGGAGCTGATGGGGTTCCCTGG - Intergenic
908318933 1:62962559-62962581 CAGGGGCTGAAGAGCTCCTGTGG + Intergenic
908509378 1:64839417-64839439 CAGCAGCTGCAGGGCTCCTGAGG - Intronic
909806230 1:79876339-79876361 CAGGGGCTCAAGTGCTCCCAGGG - Intergenic
912588226 1:110786826-110786848 CAGGACCTGAGGGTCTTCCATGG + Intergenic
913113821 1:115679157-115679179 CTGGAGCTGAAGAGATCTCAGGG - Intronic
915205729 1:154269179-154269201 CAGGAGGAGAAGGGCACCAAAGG - Intronic
916449334 1:164904841-164904863 CAGGAGTTGAAGGGCAGCCTGGG + Intergenic
917479238 1:175396674-175396696 CTGGAGCTGGAGGCCCCCCAGGG + Exonic
917666996 1:177234889-177234911 AAGAAGCTGTAGGGCTACCAGGG + Intronic
919761230 1:201099402-201099424 CTGCAGTTGAAGGGCTCCCTGGG + Intronic
919797717 1:201331399-201331421 CAGCAGCAGGAGGGCTCCCGAGG + Exonic
920077021 1:203344642-203344664 CAGGAGCTCAGGGGCGCACAGGG - Intronic
921138876 1:212286207-212286229 CAGAGGCAGAAGCGCTCCCAGGG + Exonic
922558411 1:226549775-226549797 CAGGAACAGAAGGGATCCGAGGG - Intronic
923779945 1:237013224-237013246 AAGGAGCAGAAGGGCTGGCACGG - Intergenic
924496710 1:244597213-244597235 CAGAAGCTGAAGGGCTAGTAGGG - Intronic
1065766310 10:29033405-29033427 CAGGAGCTCAATTGCTCCTAGGG + Intergenic
1066495497 10:35938087-35938109 AACAAGCTGAAGGGCACCCAGGG - Intergenic
1067113625 10:43418345-43418367 CAGGAGCAGAAGGGGTCACTAGG - Intergenic
1067556781 10:47278326-47278348 GAGGCGCTGACGGGCCCCCAAGG + Intergenic
1069729333 10:70600882-70600904 GAGGAGCAGACGGGCTGCCATGG + Exonic
1070542243 10:77424614-77424636 CAGGAGTTGAAGATCTCTCAGGG + Intronic
1070891138 10:79942851-79942873 CAGGAGCTGCAGGGCAAGCAGGG - Exonic
1073124519 10:101141183-101141205 CCTGAGCTGAAGGGCCCTCAGGG - Intergenic
1073589552 10:104743539-104743561 CAGAAGGTGAATGCCTCCCAAGG - Intronic
1074106984 10:110395847-110395869 AAGGTGTTGAAGGGCTGCCAGGG + Intergenic
1074148584 10:110738756-110738778 CTGGAGCTGAAGGAGTGCCAAGG + Intronic
1074247851 10:111713096-111713118 CAGGAACTGCAGGGCTCCAAAGG + Intergenic
1074759405 10:116655077-116655099 CTGGCTCTGAAGGGCTCCTAAGG - Intergenic
1076482748 10:130795623-130795645 CAGGAGATACAGGGCTACCAGGG - Intergenic
1076802149 10:132835760-132835782 CAGAAGCTGAAGGCCCACCAGGG - Intronic
1077044265 11:537544-537566 CTGGAGGTGGAGGGCGCCCAGGG + Exonic
1077297576 11:1833241-1833263 CAGGAGCTGAGGGGCTGCCGAGG + Intronic
1077454441 11:2670001-2670023 CAGGAGCTGTTGGGGTCCCGTGG + Intronic
1078397820 11:10997195-10997217 CATGGGAAGAAGGGCTCCCAAGG + Intergenic
1081867691 11:46368552-46368574 CAGGGGCAGAAGGGTTCGCATGG + Intronic
1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG + Intergenic
1084312834 11:68326703-68326725 CAGGAGCTCAAGGCTTCGCAGGG - Intronic
1084457375 11:69275856-69275878 CAGGACCTGAAGAGTCCCCACGG - Intergenic
1084563212 11:69915569-69915591 CCTGAGCTGCAGGGCTCCCAGGG - Intergenic
1087198530 11:95322305-95322327 CAGGATTTGAAGGTCTTCCATGG + Intergenic
1089149145 11:116351325-116351347 CAGGAGCTGGACTGCCCCCAGGG + Intergenic
1089298058 11:117481518-117481540 GAGGGGCTGAGGGGGTCCCAGGG + Intronic
1089298072 11:117481547-117481569 GAGGGGCTGAGGGGGTCCCAGGG + Intronic
1089664720 11:120010949-120010971 CAGCAGCTGACTGACTCCCATGG + Intergenic
1091383049 12:75273-75295 AAGGAGCTGAAGGGCTCATGAGG + Intronic
1091541649 12:1467983-1468005 CAGGAGGTGAAGGGCTAGCCAGG - Intronic
1091759246 12:3076769-3076791 CAGGAGCTGGCGGCCTCCAAGGG - Intergenic
1091909811 12:4220467-4220489 CAGGAACAGAGGGGCTGCCAGGG + Intergenic
1092290522 12:7157380-7157402 CCCGGGCTGAAGGACTCCCAGGG - Intronic
1092456593 12:8649367-8649389 CAGGAGCTGATGGACTCTAAGGG + Intronic
1092882465 12:12898323-12898345 CAGGAGTTGAAGAGCTGCCTGGG + Intronic
1096263966 12:50109594-50109616 CAGGATCTCCAGGACTCCCAGGG + Exonic
1096760598 12:53838952-53838974 CAAGAGCTCAAAGCCTCCCACGG + Intergenic
1096948315 12:55435003-55435025 CAGGGGCTGAAGAGCTCCTGTGG - Intergenic
1097087157 12:56477175-56477197 CATCAGCTGTAGGTCTCCCAGGG - Exonic
1100368983 12:93947754-93947776 AAACAGCTGAAGGGCTCCAAGGG - Intergenic
1100455785 12:94750426-94750448 CAGGAGCTGCAGACTTCCCAAGG - Intergenic
1102119579 12:110429766-110429788 CAGCCACTGCAGGGCTCCCATGG - Intergenic
1104611894 12:130235562-130235584 CTGGAGGTGAAAGGCCCCCAGGG - Intergenic
1105934942 13:25090020-25090042 CAGGAGCTGCAGGGGCCGCAGGG - Intergenic
1107779035 13:43879277-43879299 CAGGAGCTGCAGGTCTCCAGAGG - Exonic
1108997945 13:56759151-56759173 CAGGAGCTGGAGGGCACATAAGG - Intergenic
1111658204 13:91177714-91177736 GAGGCACTGAAGGGCTCCTAGGG - Intergenic
1112103740 13:96218249-96218271 CAGAAGCTGAAGGGCCCCCAGGG + Intronic
1112929714 13:104718812-104718834 CAGGACCTGATGGCTTCCCATGG + Intergenic
1113499327 13:110760755-110760777 TTGGAGCTGAAGAGCTCCCTTGG + Intergenic
1113702253 13:112396394-112396416 CAAGGGCAGATGGGCTCCCAGGG - Intronic
1113924752 13:113935241-113935263 GAGGAGCTGAAGGGCGCCGGGGG - Intergenic
1115762171 14:36585385-36585407 CAGGAGCTACAGGGTTTCCATGG - Intergenic
1117340151 14:54785340-54785362 AGGGAGCTGAAGGCCTCCCAGGG - Intronic
1118444710 14:65840609-65840631 CAGCGGCTGAAGGGCTGCCTTGG + Intergenic
1118905972 14:70023411-70023433 CCTGAGCTGAAGGGCTGCCTGGG + Exonic
1119501006 14:75127220-75127242 GTGGAACCGAAGGGCTCCCACGG + Intronic
1119858882 14:77922367-77922389 CAGGAGCTGGAGGGCTGGCGTGG + Intronic
1120061603 14:79989914-79989936 CAGGAGCTGAAGTCCAGCCAGGG - Intergenic
1121341270 14:93106514-93106536 CAGGAGCTAAAGGACCCACAGGG - Intronic
1122201783 14:100127169-100127191 CAGGTGCTGAAGGCCTACCTTGG + Intronic
1122586238 14:102808549-102808571 CAGGTGCTAGAGGGCTTCCAAGG + Intronic
1123129366 14:105973284-105973306 CAGGAGCTGATCAGCTCTCAGGG + Intergenic
1123409881 15:20049450-20049472 CAGGAGCTGATCAGCTCTCAGGG + Intergenic
1123519213 15:21056158-21056180 CAGGAGCTGATCAGCTCTCAGGG + Intergenic
1125646532 15:41277433-41277455 CAGGAGTTGAAGGCCTGCCTGGG + Intronic
1127768735 15:62213009-62213031 CAGGAGATGAGGGGGACCCATGG - Intergenic
1128135805 15:65262607-65262629 CAGGATGTGAAGGGCAGCCAAGG - Intronic
1129851330 15:78795572-78795594 CAGGAGGTGAGGGGCTGGCAGGG + Intronic
1131091428 15:89627441-89627463 CAGCAGCTCAAGGGACCCCAGGG - Exonic
1132032688 15:98451403-98451425 CAGGAGCTGAAGGGAAGGCAGGG - Intronic
1132063147 15:98709269-98709291 CGGGAACTGAAGGGCTACCTGGG - Intronic
1132175505 15:99711025-99711047 CAGGATCTGAAGGGGTCTGAAGG + Intronic
1132643877 16:990001-990023 TGGGAGCTGTGGGGCTCCCAGGG + Intergenic
1133212480 16:4271365-4271387 CAGGAGCGAAATGGCTCCCCAGG - Intronic
1135062669 16:19284369-19284391 CTGGAGCTGAAAGTCTGCCAAGG - Intergenic
1136101339 16:27998577-27998599 CAGGAGCTCAAGGGCAGCCTGGG + Intronic
1136188212 16:28600610-28600632 CTGGAGCTCAAGGGCTCGCAGGG + Intergenic
1136190684 16:28613604-28613626 CTGGAGCTCAAGGGCTCGCAGGG + Intronic
1137270795 16:46901233-46901255 AAGGGGCTGGAGGGGTCCCAAGG - Intronic
1137327996 16:47461042-47461064 CGGGGGCTGAGGGGCTGCCATGG - Exonic
1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG + Intronic
1138516808 16:57540633-57540655 GAGGAGCTGGAGGGCTTCCCAGG + Intergenic
1138609152 16:58109220-58109242 CAGGGGCTGCATGGCTCACATGG - Intergenic
1139023323 16:62780316-62780338 CAGGACCTGAGGGGGCCCCAGGG - Intergenic
1139249716 16:65483052-65483074 CAGGAGCTGAATGTGTCACACGG + Intergenic
1141926600 16:87174124-87174146 GAAGAGCTGAAAGGATCCCAAGG - Intronic
1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG + Exonic
1142474757 17:182154-182176 CAGGTGATCAAGGGCACCCAGGG + Intergenic
1142756424 17:2019053-2019075 CAGGAGCAGAGGGGCCTCCAGGG - Intronic
1143620248 17:8076384-8076406 GAGGACCTGAAGGGGTTCCAGGG - Intronic
1146295808 17:31649525-31649547 CAGGAGCAGCAGGGCTTACATGG + Intergenic
1147163402 17:38580387-38580409 CAAGGGAAGAAGGGCTCCCATGG + Intronic
1147882531 17:43663172-43663194 GAGGAGCCGAAGGGCACCCAGGG + Intergenic
1147969605 17:44212423-44212445 AAGGAGGTGAAGGACTCCCTGGG - Exonic
1149849157 17:60025254-60025276 CAGGTGATCAAGGGCACCCAGGG - Intergenic
1149861011 17:60121270-60121292 CAGGTGATCAAGGGCACCCAGGG + Intergenic
1150592824 17:66578341-66578363 CTGGAGCTGAAGGGTTTCCAAGG - Intronic
1150651998 17:67016416-67016438 CAGCAGCTGAAGGGGCCCAATGG + Intronic
1151340935 17:73470522-73470544 CAGCGGCTGGAGGGCTCCCCGGG - Intronic
1151717719 17:75839968-75839990 CAGGACCTGAAGGGCAGCCCCGG + Intronic
1151818576 17:76484387-76484409 CCTTGGCTGAAGGGCTCCCAGGG - Intronic
1151831250 17:76553100-76553122 TAGGAGCTGAAGGACTGCGATGG - Intronic
1151974234 17:77475500-77475522 TAGGACCTGAAGTGCCCCCATGG + Intronic
1152741085 17:82018625-82018647 CAGGAGTGGAAGGGCACACACGG + Intergenic
1155501534 18:26491700-26491722 CGGGGGCTGAAGGGCTCACATGG + Intronic
1157454568 18:47814511-47814533 CAGGAGTGGAATGACTCCCAGGG + Exonic
1158302256 18:56065250-56065272 CAGCAGCAGACGGCCTCCCAGGG - Intergenic
1160261710 18:77300487-77300509 CTGGAGCTGGAGGGCTCTCAAGG - Intergenic
1160662870 19:309155-309177 CAGGAGCTGGAGGGCTCTGAGGG - Intronic
1160694778 19:478209-478231 CAGGACCCCAGGGGCTCCCACGG + Intergenic
1160955685 19:1690784-1690806 CAGGAGCTGAGGGTCTAGCAGGG - Intergenic
1161069078 19:2251536-2251558 CAGGAGCAGCAGCGCTCGCAGGG - Exonic
1161141954 19:2653465-2653487 CAGGAGCTGGGGGGCCCCCCTGG + Intronic
1161288472 19:3480434-3480456 CAGCACCAGAAGGGCCCCCAGGG + Exonic
1161311676 19:3598008-3598030 CAGCAGCTGAGGAACTCCCAGGG + Intronic
1161363796 19:3867485-3867507 CAGGGGCAGAAGGGCTCAGAGGG - Intronic
1162180583 19:8866063-8866085 CAGGTGCTGAAGGACCCCCTCGG + Exonic
1162320748 19:9969653-9969675 CAGGTCCTGATGGGCCCCCAGGG - Exonic
1162620305 19:11837856-11837878 CAGGAGCTCAAGACCTGCCATGG + Intergenic
1165017345 19:32890720-32890742 CAGGGGTTGAGGGGCTCCCCTGG - Intronic
1166260981 19:41640584-41640606 GAGGGGCTGAGGGGGTCCCAGGG + Intronic
1167003892 19:46762844-46762866 CAGGAGGTGGAGGCCACCCAGGG + Intronic
1167018699 19:46858908-46858930 TCAGAGCTGATGGGCTCCCAAGG + Intergenic
1167570054 19:50281333-50281355 CAGCAGCCGAGGGGCTCCCCAGG + Intronic
925206688 2:2013318-2013340 CTGGAGCTGAAGGGCACAAAGGG - Intronic
926341900 2:11910579-11910601 CAGGGGCTCAAGAGCTGCCAAGG - Intergenic
926549864 2:14288416-14288438 CAGGACCTGAAGGATTCCCATGG - Intergenic
927444993 2:23151899-23151921 CATGCCCTGAAGGGCTCCCAGGG + Intergenic
927842994 2:26457098-26457120 CAGTACCAGCAGGGCTCCCATGG - Intergenic
928328924 2:30342299-30342321 GAGGAGGTGAAGGGCTACAACGG + Intergenic
933992947 2:87646775-87646797 CAGGAGCTGACAGGCGTCCAGGG - Intergenic
936300910 2:111304104-111304126 CAGGAGCTGACAGGCGTCCAGGG + Intergenic
937126526 2:119478353-119478375 CAGGAGGCCAGGGGCTCCCAGGG + Intronic
938092148 2:128441018-128441040 CAGCATCTGATGGGCTCCCCTGG - Intergenic
938307792 2:130266683-130266705 CAGGAGCTGGAGGGCAGCCAGGG - Intergenic
938447545 2:131390158-131390180 CAGGAGCTGGAGGGCAGCCAGGG + Intergenic
938873504 2:135507744-135507766 CAGGAGCTGAAGATCAGCCAGGG + Intronic
940325619 2:152422229-152422251 CAGAAGCTGAAAGCCTCCTAGGG + Intronic
940336732 2:152536728-152536750 CAGGGGATGAATGGCTCTCAGGG - Intronic
940362776 2:152813751-152813773 CAGGGGCTGTTGGGCCCCCAGGG + Intergenic
940739737 2:157493615-157493637 TAGGACCTCAAAGGCTCCCAGGG + Intergenic
941106401 2:161359178-161359200 CAGGAGCTGAAGACCACCCTGGG - Intronic
943524543 2:188999858-188999880 CAGGTGCTGATGGTGTCCCAGGG + Exonic
944471245 2:200055583-200055605 CAGGAGGTCAAGCGCTCACAAGG - Intergenic
944498727 2:200335438-200335460 AAGGACCTGGAGGGCTTCCAAGG + Intronic
946436327 2:219658301-219658323 CAGGAACTTAAAGGTTCCCAGGG - Intergenic
947173500 2:227336900-227336922 CAAATGCAGAAGGGCTCCCAGGG + Intronic
948169377 2:235888786-235888808 CAGGAGCTGAAGTGGCCACAGGG - Intronic
948880230 2:240853070-240853092 GAGGCACTGAAGGGCTTCCATGG - Intergenic
1169649635 20:7852654-7852676 CATGAGATGAAGGGCATCCAAGG - Intergenic
1170773535 20:19355505-19355527 CTGGAGCTGTAGGACCCCCAGGG + Intronic
1172619375 20:36309025-36309047 CAGGAACTGAAGGCCCGCCAGGG - Intronic
1172655238 20:36532787-36532809 CAGAAGATGGTGGGCTCCCAAGG + Intergenic
1172696787 20:36828453-36828475 CAGGAGGAGAAGGTCTGCCAGGG + Intronic
1173789422 20:45818067-45818089 CAGGTTCTGAAGGTCTCCCACGG + Intergenic
1173894659 20:46541742-46541764 CAGGAGCTGCAGGGCCCCCGCGG + Exonic
1176100498 20:63362286-63362308 CAGGAGCTGTAGGGCTCCAGAGG - Intronic
1176282134 20:64319486-64319508 AAGGAGCTGAAGGGCTCATGAGG - Intergenic
1178391950 21:32206013-32206035 CAGGAGCTGAAGGGAAAACAAGG - Intergenic
1178908631 21:36656241-36656263 CAGGTGCTGACGGGCTTCCGTGG - Intergenic
1180623212 22:17176059-17176081 CTGGAGCTGACGGGCCGCCAGGG - Intergenic
1180709601 22:17830875-17830897 CTGGAGCTGCACAGCTCCCAGGG + Intronic
1180975985 22:19848739-19848761 CAGGAGCTGCCTGGGTCCCAAGG + Exonic
1181022806 22:20112519-20112541 CAGGAGCTGAAGGGCTCCCAGGG - Exonic
1181040772 22:20191662-20191684 CAGGAGGGGAAGGCCACCCATGG + Intergenic
1181234794 22:21442507-21442529 CAGGAGATTAAGGACACCCAGGG - Exonic
1181243856 22:21492324-21492346 CAGGAGATTAAGGACACCCAGGG + Intergenic
1182662221 22:31933237-31933259 CAGAAGCAGAAGGGCCCTCATGG - Intergenic
1183317821 22:37146531-37146553 CAGGATCTGTAGGGGACCCAGGG - Intronic
1183468386 22:37991934-37991956 CAGCAGATGAAGGGCTTGCATGG + Intronic
1183565198 22:38609466-38609488 CGAGAGCTGGAGGGCTTCCAAGG + Intronic
1185058160 22:48591951-48591973 CAGTGGCTGAAGGGCGCTCAGGG - Intronic
1185080780 22:48708339-48708361 GAGGAGCTGAAGGGCCCTCCGGG - Intronic
1185416234 22:50711983-50712005 CAGGAGGGAAAGGGCTCCGAGGG + Intergenic
949540627 3:5029304-5029326 CAGGAGCTCAAGAGCTGCCTGGG - Intergenic
950404943 3:12798387-12798409 CAGGAGCTCAGGGTCTCCCAGGG - Intronic
950770497 3:15307130-15307152 CGGGAGCTGAGGTGCTCCCATGG - Intronic
953882065 3:46695744-46695766 CAGGAAGGGAAGGGCTCCCACGG + Intergenic
953916899 3:46926152-46926174 CAGGTGCTGGAGGGCTCCAGAGG + Intronic
954405944 3:50345128-50345150 CAGGAGCTGCTGGTCACCCATGG - Exonic
954464299 3:50645701-50645723 CAGGACCTCAGGGGCTGCCAGGG - Exonic
955023645 3:55145775-55145797 CTGCAGCTGGAGGGCTCACAGGG + Intergenic
956786537 3:72647518-72647540 CAGCAGGTGCAGGGGTCCCAAGG + Intergenic
960246285 3:115403950-115403972 CAGGAGCTTAAGGGCTATCTTGG + Intergenic
961644808 3:128387165-128387187 CAGGGGCTGCAGGGGTCACAGGG + Intronic
962240975 3:133750595-133750617 CTAGAGCTGCAGGGTTCCCAGGG - Intronic
968912832 4:3484665-3484687 CAGCAGCAGGAGGGCCCCCAGGG - Intronic
970632810 4:17970590-17970612 CAGGAGCCCAAGGGCTTCAATGG + Intronic
971381344 4:26101183-26101205 CATGAGCTGGAGTGCTCCAAAGG - Intergenic
973148808 4:46862106-46862128 CAGCAGCTCAAGGACTCCAAGGG + Intronic
974380140 4:61128935-61128957 CAGGTGCAGCAGGGCTCTCAGGG - Intergenic
974894835 4:67926701-67926723 CAGGCTCTGGGGGGCTCCCAGGG - Intronic
977403309 4:96563063-96563085 CAGGAGCTCAAGGGCAGCCTGGG + Intergenic
978532801 4:109731107-109731129 CAGGAGTTCCAGGCCTCCCAAGG - Intergenic
979813062 4:125064370-125064392 CAAGGCCTGAAGGGCTCTCACGG - Intergenic
981058472 4:140392664-140392686 CAGCTGCTGAAGGGCACCCATGG - Exonic
982042783 4:151411556-151411578 CAGGAGCTCAAGGGCAGCCTGGG - Intronic
983359794 4:166713351-166713373 TAGGAGCTCGAGGGCTTCCAGGG - Intergenic
984048686 4:174836385-174836407 CTGAAGCTGAAGGGTGCCCAAGG + Intronic
985062422 4:186092495-186092517 CAGGAGCAGCCGGGCACCCACGG - Intergenic
985748565 5:1661560-1661582 CAGGAGCAGCTGAGCTCCCAGGG - Intergenic
987474655 5:18375753-18375775 CGGGAGCAGAAGGGCTGCCTGGG - Intergenic
988621522 5:32828390-32828412 CTGGGGCTGCAGTGCTCCCAAGG + Intergenic
992110844 5:73491643-73491665 CAGGAGCTGAAGGCCAGCCTGGG + Intergenic
992732331 5:79684462-79684484 CAGGAGCTGAAGGCCAGCCTGGG - Intronic
993100018 5:83526487-83526509 CAGGAGATGAGGAGGTCCCAAGG - Intronic
993138693 5:84002873-84002895 CAGGGGTTGAAGGGTTCACAGGG - Intronic
994245644 5:97472170-97472192 CAGGCTCTGCGGGGCTCCCAAGG + Intergenic
994400525 5:99274234-99274256 CAGCAGCTGCAGGGCTTCCGGGG - Intergenic
994724847 5:103422637-103422659 CAGGAGCTCCAGGGCACCAAGGG - Intergenic
997235123 5:132268189-132268211 CAGCAGCTGAGGGGCTGCCCTGG - Intronic
997525213 5:134548691-134548713 CAGGGCAGGAAGGGCTCCCAGGG - Intronic
998154556 5:139777159-139777181 CAGGAGATGAAGGGCTGAAAAGG - Intergenic
999320862 5:150614302-150614324 CAGCAGCAGAAGGGATGCCAGGG + Intronic
1001093865 5:168761300-168761322 AAGGAGCTGAAGGGCTTGGAGGG - Intronic
1001535520 5:172495251-172495273 CTGGAGCTAAATGGCTCTCATGG - Intergenic
1001692001 5:173640049-173640071 ATGGAGCTTAAGGTCTCCCAGGG + Intergenic
1001881637 5:175249709-175249731 CAAGAGCAGAAGGACTCTCAGGG + Intergenic
1002861019 6:1079623-1079645 CATGAGCTGAGGGTTTCCCATGG - Intergenic
1002956387 6:1869492-1869514 CAGGAGCTGAAGGGCTGTCAAGG + Intronic
1002980868 6:2136511-2136533 CAAGAGCTCAAGGCCTCCCTGGG + Intronic
1004472714 6:15943480-15943502 CAGGAGCTAAAGGATTCCAAAGG - Intergenic
1005809255 6:29503688-29503710 GAGAAGCTGCAGGGCTCCCAGGG - Intergenic
1005994755 6:30924391-30924413 CAGGACCTGAGGGGGCCCCAGGG - Exonic
1006395031 6:33781760-33781782 CAGGGGCTGAGGGCTTCCCAGGG - Intronic
1006474337 6:34245055-34245077 CAGCCGCTGCAGGGCTCCCATGG + Exonic
1013289389 6:108707722-108707744 CAGGAGATGAAGGCCTGGCAAGG - Intergenic
1013586180 6:111581104-111581126 CAGGAGCAGGAGGGTCCCCAGGG + Intronic
1014069857 6:117168639-117168661 CAGGAGCATAATGGCTTCCATGG - Intergenic
1016789420 6:148052332-148052354 CAGGAGAGGAAGGGAGCCCAGGG + Intergenic
1018085450 6:160297635-160297657 CAGGAGGAGGAGGACTCCCAGGG + Intergenic
1018166078 6:161098308-161098330 CAGCAGCAGCAGGGCTGCCATGG - Exonic
1019141236 6:169945232-169945254 CAGGAGCTGAATAGATACCACGG - Intergenic
1019347593 7:538482-538504 CAGGAAGTGAAGGGCTGGCATGG - Intergenic
1019443463 7:1059284-1059306 CCAGAGCTGAAGGGCCCCCAGGG + Intronic
1019667083 7:2257316-2257338 CGGGAGGGGAAAGGCTCCCACGG + Intronic
1020711557 7:11612326-11612348 CAGGAGATGAAGAGGTCTCATGG + Intronic
1022039710 7:26568638-26568660 CTTGAGGTCAAGGGCTCCCAAGG - Intergenic
1022230116 7:28406326-28406348 CAGCAACTAAAGGTCTCCCAGGG + Intronic
1023834159 7:44058692-44058714 CAGAAGCCAAGGGGCTCCCAGGG - Intronic
1026481134 7:70780582-70780604 CAGGAGTTGAAGGGCAGCCTGGG - Intronic
1027144062 7:75681713-75681735 CAGGAGTTCAAGGCCACCCAGGG - Intronic
1027163930 7:75821557-75821579 CAGGGGCTGTGGGGCTTCCAGGG + Intronic
1029302938 7:99598841-99598863 CAGGCGCTGAAGGGGGCCTAGGG + Intronic
1029406135 7:100374926-100374948 CAGGGACTGCAGGGCTCCCAGGG - Intronic
1030659836 7:112206887-112206909 CCAGAGCTGAAGGGCTCCTAGGG - Intronic
1033406927 7:141078870-141078892 CAGGAGCTGGAGAGCAGCCATGG + Intronic
1034317387 7:150145259-150145281 GAAGACCTGAAGGGCTCCCCTGG + Intergenic
1034775364 7:153821968-153821990 GAAGACCTGAAGGGCTCCCCTGG - Intergenic
1035215635 7:157364486-157364508 CAGGAGTTCAAGGCCTCCCTAGG - Intronic
1035913963 8:3598674-3598696 CAGTAGCTGAAGGGTTGCCTTGG + Intronic
1036193656 8:6694730-6694752 CAGGAGTTAAAGAGCTCCCTGGG + Intergenic
1038566476 8:28623279-28623301 CAGGGACTGGAGGGCACCCACGG - Intronic
1039033067 8:33330732-33330754 CAGGAGGTGAAGGGAGCCAAAGG - Intergenic
1039519193 8:38156153-38156175 CAGGAGCTGAAGACCAGCCAGGG - Intergenic
1040277649 8:46022113-46022135 CGGATGCTGAAGGCCTCCCACGG - Intergenic
1041405688 8:57496891-57496913 CAGGACATTAAAGGCTCCCATGG + Intergenic
1041699401 8:60771784-60771806 CAGGAGCTGAAGGTGGCCCCAGG - Intronic
1048871636 8:138804022-138804044 CAGGAGCTGAGGGGCTGAGAGGG - Intronic
1049320999 8:141996336-141996358 CAGGTGCTGTAGGTATCCCAGGG - Intergenic
1049427822 8:142545131-142545153 CAGGAGCTGCAGGGCCCACCTGG - Intergenic
1049431101 8:142565431-142565453 CAGCAGCTCTTGGGCTCCCAAGG + Intergenic
1049570290 8:143367138-143367160 GACAAGCTGAAGGGCTCCCAGGG + Intergenic
1049638888 8:143705487-143705509 CAGGAGCTTGAGGACCCCCAGGG - Intronic
1050261982 9:3850267-3850289 CATGAGCTGAAGGCCACGCAAGG + Intronic
1050910434 9:11062152-11062174 AAGGAGGTGAATGGCTTCCAGGG + Intergenic
1051245750 9:15109220-15109242 CAGGAGCTCAAGGGCAGCCTGGG + Intergenic
1052649969 9:31290394-31290416 CGGCCACTGAAGGGCTCCCAGGG + Intergenic
1053420029 9:37971500-37971522 CAGGAGCTGGAGGGGTCCTATGG - Intronic
1053431463 9:38044437-38044459 AAGGAGCTGAAGCACTCCTAAGG + Intronic
1057348050 9:94269380-94269402 CAGGAGTGGATGGGCTCCAAGGG - Intronic
1059258535 9:112953711-112953733 CAGGGGCTGAAGGACTCCTAAGG + Intergenic
1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG + Intronic
1061714835 9:132512201-132512223 CAGTGGCTGAAGGGATGCCAAGG - Intronic
1061820789 9:133226289-133226311 CAGGAGCTGCGGGGCTTGCAGGG - Intergenic
1062215054 9:135384593-135384615 CAGGGGCGGAAGGGTCCCCAGGG - Intergenic
1062357298 9:136170905-136170927 CAGGATCTGCAGGGGTCCCAGGG - Intergenic
1187071010 X:15888342-15888364 GAGCATCTGCAGGGCTCCCACGG + Intergenic
1187697854 X:21939434-21939456 CAGGAGCAGTAGGGCTCCATGGG - Intergenic
1188156447 X:26748526-26748548 CAGCAGCTTCAGGGCCCCCATGG + Intergenic
1189217718 X:39341359-39341381 AAGGAGCAGAAGGGCTACTAAGG + Intergenic
1193574940 X:83185400-83185422 AAGGAACTGCAGGGCCCCCAAGG + Intergenic
1195845312 X:109221247-109221269 CAGCAGCTGAAGGCCACACACGG + Intergenic
1197547838 X:127848784-127848806 CACAAGCTGGAGGGCTCACAAGG + Intergenic