ID: 1181022987

View in Genome Browser
Species Human (GRCh38)
Location 22:20113220-20113242
Sequence CTCTTCAGAGTTGAGTAATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181022987_1181022990 0 Left 1181022987 22:20113220-20113242 CCACATTACTCAACTCTGAAGAG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1181022990 22:20113243-20113265 ATGGCACCGTGGCCTGTCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 187
1181022987_1181022991 1 Left 1181022987 22:20113220-20113242 CCACATTACTCAACTCTGAAGAG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1181022991 22:20113244-20113266 TGGCACCGTGGCCTGTCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 170
1181022987_1181022994 21 Left 1181022987 22:20113220-20113242 CCACATTACTCAACTCTGAAGAG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1181022994 22:20113264-20113286 GGGCCACATGCCCTCCCAGCAGG 0: 1
1: 1
2: 5
3: 26
4: 265
1181022987_1181022995 22 Left 1181022987 22:20113220-20113242 CCACATTACTCAACTCTGAAGAG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1181022995 22:20113265-20113287 GGCCACATGCCCTCCCAGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181022987 Original CRISPR CTCTTCAGAGTTGAGTAATG TGG (reversed) Exonic
913169296 1:116217888-116217910 CTCTTCGGGGTAGAATAATGAGG + Intergenic
914347238 1:146810309-146810331 ATCTGCAGAGTTGAGCACTGTGG - Intergenic
915760882 1:158311325-158311347 CTTTTCAGAGTTGTCTAATCAGG + Intergenic
923118476 1:230967055-230967077 CTGTAAAGAGTTCAGTAATGTGG - Intronic
1062924111 10:1301602-1301624 CTCTTCAGGGTTCATTAATTTGG + Intronic
1065862044 10:29880048-29880070 CTCTTTCCAGTTGTGTAATGAGG + Intergenic
1067801122 10:49360439-49360461 CTCTGCTGAGTGGAGGAATGAGG + Intergenic
1068814831 10:61297411-61297433 CTGTTTAGAGTTGAATACTGAGG - Intergenic
1069655297 10:70083313-70083335 CACTTAAGAGTTGTGTAATGAGG - Intronic
1070579178 10:77705853-77705875 CTCTTTAGAGATGAGGAATCTGG - Intergenic
1072129877 10:92483967-92483989 CTCTTCCAAGTTCAGTTATGTGG - Intronic
1073187673 10:101626440-101626462 CTCTCCAGATTTGAGGAGTGGGG + Intronic
1075374541 10:121967874-121967896 CTCTTAAAGGTTGAGTGATGCGG - Intronic
1075865094 10:125711682-125711704 CTTTTCAGAGTTTTGTGATGAGG - Intergenic
1075900951 10:126042500-126042522 TTCTTCAGAGTTGTATAAGGAGG + Intronic
1077223607 11:1428039-1428061 GTCTTCAGAGTACAGTAATGGGG + Intronic
1077625587 11:3768523-3768545 ATTTTTAGAGTTAAGTAATGAGG - Intronic
1078210884 11:9268469-9268491 CACTTCACAGTTGAGTATTCTGG - Intergenic
1080035387 11:27704386-27704408 CTGTTCTCACTTGAGTAATGAGG - Intronic
1082109872 11:48262716-48262738 CTCTGCAGAAGTGAGTGATGTGG - Intergenic
1084719742 11:70897024-70897046 CTCATCAGATTTCAGTTATGTGG + Intronic
1085926281 11:81026367-81026389 CTCTCCAGAGTTGATTAATATGG + Intergenic
1086056406 11:82652780-82652802 CTCTTCAGAGCTAAGCAATAAGG - Intergenic
1086520282 11:87661244-87661266 CTGCTCAGAGGTGAGTAGTGGGG + Intergenic
1092764538 12:11840735-11840757 ATCTTCAAAATTGAGTAATTTGG + Intronic
1093799322 12:23352915-23352937 CCCTCCAGAGTAGAGAAATGAGG - Intergenic
1094704136 12:32897982-32898004 CACTTCAGACTTGAGTAAGTGGG - Intergenic
1095692889 12:45110703-45110725 CTCTTCAGTTTTCTGTAATGAGG + Intergenic
1097014330 12:55974429-55974451 CTCTTCAGCGCTGCTTAATGAGG - Intronic
1099202795 12:79694525-79694547 CTGTTCATAGCTGAGTCATGTGG + Intergenic
1102944254 12:116971754-116971776 CACAGCACAGTTGAGTAATGGGG - Intronic
1108167186 13:47705917-47705939 CAATTCAGAGGTGAGTAAGGAGG + Intergenic
1110100148 13:71590422-71590444 TTCTTCAGAATTGAGAAATTTGG - Intronic
1111731528 13:92083234-92083256 CTTTTCAGAGAAGAGCAATGGGG - Intronic
1111755317 13:92386957-92386979 TTCTTCAGAGGTGAGTAAACTGG - Intronic
1112230254 13:97582850-97582872 CTCTTCAGAGTTCAGTCAACTGG - Intergenic
1113756793 13:112817962-112817984 CTCTTCACATTTGTGAAATGGGG + Intronic
1115095768 14:29633941-29633963 TTCTTAATAGTTGAGGAATGAGG - Intronic
1121869861 14:97397176-97397198 ACCTTCTGAGGTGAGTAATGAGG - Intergenic
1123670024 15:22647082-22647104 CTTTTCAGAGAAGAGCAATGGGG - Intergenic
1124525996 15:30453497-30453519 CTTTTCAGAGAAGAGCAATGGGG - Intergenic
1124772659 15:32554188-32554210 CTTTTCAGAGAAGAGCAATGGGG + Intergenic
1124996689 15:34730247-34730269 CTCTTCAGTGTTGAGGAAGATGG - Intergenic
1125062124 15:35437335-35437357 TTCTTCACAGATGAGTAATTGGG + Intronic
1125821459 15:42635635-42635657 CTCTTCAGGGTTTAATAAAGAGG - Intronic
1126275394 15:46873069-46873091 CTGTTCATAGTAGAGAAATGAGG - Intergenic
1126296059 15:47136096-47136118 CTCTTCAATTTTTAGTAATGAGG + Intergenic
1131342892 15:91619435-91619457 TTCTTCAAAGTTCAGCAATGTGG + Intergenic
1131385461 15:92002945-92002967 CTGTTCAGATTTGAGAATTGAGG - Intronic
1134378519 16:13702208-13702230 CTCTTAAGGGTTTAGTTATGAGG + Intergenic
1137663731 16:50234930-50234952 GTCTTCAGTGTTAAGAAATGTGG + Intronic
1139048097 16:63087927-63087949 CTGTGCAGAGTTGAGTACTTGGG + Intergenic
1139637739 16:68268392-68268414 CTCTTCTGTGTTGATTATTGTGG + Intronic
1139965062 16:70740773-70740795 CTCTGCACAGGTGAGGAATGAGG + Intronic
1139986752 16:70904959-70904981 ATCTGCAGAGTTGAGCACTGGGG + Intronic
1143990352 17:10954416-10954438 ATCTTCAGAGTTGGCTATTGGGG + Intergenic
1149295089 17:55254745-55254767 GTTTACAGAGTTCAGTAATGTGG - Intergenic
1157131050 18:45007720-45007742 CTCTTCAGAATTGAGTCAGCTGG + Intronic
1157157338 18:45280799-45280821 CTCTTCAGAGATGATTCAAGAGG - Intronic
1158766132 18:60452511-60452533 TACTTAAGAGTTGAGTAAAGTGG + Intergenic
1165962105 19:39543687-39543709 CCATTCAGAGTGGAGGAATGTGG + Intergenic
925828244 2:7871729-7871751 CTCTACACAGTTGAGTTATATGG - Intergenic
926252280 2:11161903-11161925 CTCTTCAGAGTGGAGGAAGGAGG + Intronic
926352715 2:12011431-12011453 CCCTTCAGGGATGAGTAATCTGG - Intergenic
927487627 2:23499570-23499592 CTTCTCAGAGTTGGGCAATGAGG + Intronic
928483669 2:31708260-31708282 TGCTTCAGAGTTAAGTTATGTGG - Intergenic
930559202 2:52938982-52939004 ATCTTCAGTGTTGATTGATGTGG + Intergenic
931576153 2:63721253-63721275 CACTTCAGAGTGGTGTCATGAGG + Intronic
932168604 2:69532430-69532452 TTCTGCAGAGGTGAGAAATGTGG - Intronic
935311204 2:101785422-101785444 CTCTTCAGATTGGAGTCTTGAGG + Intronic
936767832 2:115875370-115875392 TTCTTCAGTGTTGAGAAGTGTGG - Intergenic
939012678 2:136864862-136864884 CTCTTGATAGCTGAGTAATATGG + Intronic
939117964 2:138082800-138082822 CCCTTCTGAGGTGAATAATGGGG + Intergenic
942913097 2:181269848-181269870 TTCTACAGAGGTGAGGAATGGGG + Intergenic
943181000 2:184540907-184540929 CTTTTCACAGTTGAGCATTGAGG + Intergenic
943579839 2:189672331-189672353 CAGTTAACAGTTGAGTAATGTGG - Intergenic
946125948 2:217562844-217562866 GTATGCAGAGTTGAGCAATGTGG - Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947622617 2:231600521-231600543 CTCTTCTGTGTTGAGAAGTGAGG + Intergenic
1169729301 20:8769047-8769069 TTCTTCAAAGTTGAATAATTAGG + Intronic
1169939829 20:10925104-10925126 CTCTTCAAAGCTGAGCCATGTGG - Intergenic
1169945347 20:10982457-10982479 CTCTTTAGAGATGTGTAATGTGG - Intergenic
1173797827 20:45874967-45874989 CTCCTGAGAGTTGTGTCATGGGG - Intronic
1173978747 20:47206943-47206965 ATCTTCAGATTTGAGTCATGTGG + Intergenic
1174059503 20:47822515-47822537 CTCTTCAGTGTTGAGGAAATTGG + Intergenic
1179407930 21:41140586-41140608 CCCATAAGAGTTGAGAAATGCGG - Intergenic
1181022987 22:20113220-20113242 CTCTTCAGAGTTGAGTAATGTGG - Exonic
1181290487 22:21789022-21789044 CTCTTCATAGTTGATTAACTTGG + Intronic
1182915748 22:34028410-34028432 CTATTCACAGCTGAGCAATGTGG + Intergenic
1183267442 22:36837767-36837789 CTCTGCAGAAATGAGTGATGGGG + Intergenic
1184514992 22:44956374-44956396 CCGTTAAGTGTTGAGTAATGAGG - Intronic
950335722 3:12191230-12191252 CTCTTCAGAGGGGAGAAAAGGGG - Exonic
952845020 3:37681052-37681074 CTCTTCACGGATGGGTAATGAGG + Intronic
955595144 3:60581728-60581750 TTCTGCAGAGTTTAGTGATGAGG + Intronic
956257995 3:67304766-67304788 ATCTTCAGACTTGAGTGTTGGGG + Intergenic
957924180 3:86787525-86787547 ATCTTCAGGGTAGAGTAAGGGGG - Intergenic
958143822 3:89598496-89598518 CTCTTCCTAGTAGAGTAATCCGG + Intergenic
960545588 3:118911065-118911087 TGCTTCAGAGTTGAGTGTTGGGG - Intronic
964971274 3:162565740-162565762 GTCTTCATAGTTGATTTATGTGG - Intergenic
965956214 3:174373098-174373120 TTCTTCAGTGTTGAGTTATACGG - Intergenic
966154510 3:176901491-176901513 TTATTCACAGTTGAGTCATGTGG - Intergenic
969092351 4:4704237-4704259 CCCTTCTGACTTGAGTAGTGTGG + Intergenic
969881149 4:10175128-10175150 CTCGTCTGAGATGGGTAATGTGG + Intergenic
972791007 4:42371004-42371026 CTCATCAGAGTTGACTAAAAAGG + Intergenic
973954309 4:56048612-56048634 CTCCTGAGAGTTGAGTAAGTTGG - Intergenic
975940492 4:79638670-79638692 TTCCTCACAGTTGTGTAATGAGG - Intergenic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
978553680 4:109955308-109955330 CTTCTCAGAGCTGAGCAATGAGG - Intronic
978869951 4:113563750-113563772 CACTCCAGACTTGAATAATGTGG - Intronic
979419243 4:120483271-120483293 ATCTACAGAGATGAGAAATGGGG + Intergenic
982742844 4:159075816-159075838 CTCTTCAGTATTTTGTAATGAGG + Intergenic
985980843 5:3461833-3461855 CTTCTCAGAGTTGTGTAGTGTGG + Intergenic
986934907 5:12871456-12871478 CTCTTCAGAGTTTAATAAACAGG + Intergenic
988297792 5:29389041-29389063 ATCTTCACAGTTAAGTAAAGAGG - Intergenic
990314207 5:54568637-54568659 CTCTTTAGAGTTGAGTCACATGG - Intergenic
993632323 5:90301056-90301078 CTCTTCTGAGATGAGTAACCTGG + Intergenic
994956960 5:106545019-106545041 CTCTTCAGAGTTCAGACATTAGG + Intergenic
997721785 5:136083742-136083764 CCCTTCAGGGTTGATTAAGGGGG + Intergenic
998964935 5:147529055-147529077 ATCTTCAGAGATGAGAAATAAGG + Intergenic
1001612722 5:173016359-173016381 CTCTTCTGTGTTGATTATTGTGG + Intronic
1003457053 6:6292874-6292896 CTCTTCAGAGGAGAGGGATGGGG - Intronic
1005449486 6:25958995-25959017 CTCTTCACAGTTGAATACTAGGG - Intergenic
1008431069 6:51417638-51417660 CCCTGCAGATTTGAGTAATTTGG + Intergenic
1014953177 6:127583584-127583606 CTCTCTTGAGTTGAGAAATGTGG + Intronic
1018514576 6:164564472-164564494 CTCTTCAGATTAGAGCAATATGG + Intergenic
1019282755 7:208692-208714 ATATTCAGGGTTGAGTACTGGGG - Intronic
1019283182 7:210783-210805 CTCCTCAGAGATGAGAAACGGGG - Intronic
1020473709 7:8569794-8569816 GCCTTCAGTGTTGAGTAGTGTGG - Intronic
1020973541 7:14978390-14978412 CTCTTTAGAGTTAATGAATGTGG - Intergenic
1021216745 7:17925299-17925321 GTCTTCAGTTTGGAGTAATGAGG + Intronic
1021634354 7:22676904-22676926 CTATTCAGAGCTGAGTCATGGGG + Intergenic
1022105727 7:27195756-27195778 CTCTTGAGAGGTCAGTAAAGAGG - Exonic
1023184352 7:37517438-37517460 CTCTTCAAAATTGTGTGATGTGG - Intergenic
1024752244 7:52480985-52481007 ATCTTTAGTGTTGACTAATGAGG - Intergenic
1025235401 7:57231477-57231499 CTCTTCAGTGTTGAGGAAATTGG - Intergenic
1030962564 7:115945442-115945464 CTCTTTAGGGTTTAGCAATGAGG - Intronic
1035327622 7:158075214-158075236 CTGTTCAGAATGGAGTCATGGGG + Intronic
1037642437 8:20758848-20758870 CTTTTGAGAGATGACTAATGTGG - Intergenic
1041742535 8:61171702-61171724 CTCTTAAGAGATAAGGAATGTGG - Intronic
1043452101 8:80378275-80378297 CTCTACAAAGTTGAGTAATCAGG - Intergenic
1044188055 8:89280273-89280295 CTCTTTAGAGTTCAATGATGTGG - Intergenic
1050141898 9:2524835-2524857 CTGTTCAGTGATGAGAAATGAGG - Intergenic
1051949204 9:22610318-22610340 CAGTTCAGAGTAGAGTACTGGGG - Intergenic
1052430931 9:28365705-28365727 CTTTTCAGAGTTAAAGAATGGGG + Intronic
1053463401 9:38287985-38288007 CATTTCAGAGTTGAGTCTTGAGG + Intergenic
1057933513 9:99216844-99216866 CTCTTAAGAGTTGATAAATGTGG + Intronic
1061713916 9:132506733-132506755 CTATTCAGAGTTAGTTAATGAGG - Intronic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1193248707 X:79262463-79262485 CTCTGCAGTGTTCAGTGATGAGG - Intergenic
1193921734 X:87436286-87436308 CTCTTCATAGTTGAAAAAAGAGG + Intergenic
1194659369 X:96612585-96612607 CTCTTCAAATGTGAGAAATGTGG - Intergenic
1194813806 X:98418037-98418059 CTCTTCAGAGTTAATAACTGCGG + Intergenic
1195004886 X:100676162-100676184 CTCCTCAGGGATCAGTAATGGGG - Exonic
1195137582 X:101924834-101924856 TTCTTCAGAGTGGAGAAATATGG + Intronic
1196568646 X:117239181-117239203 CTCCTCAGAGTTGTGCAACGTGG - Intergenic
1197811180 X:130444756-130444778 TTCTTCTGAGTTGATAAATGAGG + Intergenic
1198594636 X:138223075-138223097 CTTTTCACAGTAAAGTAATGGGG + Intergenic
1199545568 X:149004631-149004653 GTCCTCAGAGTTGAGAATTGTGG - Intergenic
1200801276 Y:7389100-7389122 CTCTTCAGAGTTGGGAAAGTTGG - Intergenic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic
1201904037 Y:19071629-19071651 TTTTTTAGAGTTAAGTAATGAGG + Intergenic